Labshake search
Citations for Qiagen :
701 - 750 of 10000+ citations for Mouse Protein Patched Homolog 2 PTCH2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... DNA was isolated from 2 g of homogenized material from frozen needles using the DNeasy Plant Maxi Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... MCMBP depleted cells using siRNA and MCMBP-KO (clone #1 and #2) cells was isolated using RNeasy Mini Kit (Qiagen, 74104). The cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplicons were separated on a 1-2% agarose gel and appropriate bands were excised and isolated using a gel extraction kit (Qiagen, USA). These fragments were inserted into the pcDNA3.1-based plasmid or cFUGW lentivirus vector using the T4 ligase (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: Isolated Chromatin was digested with 1% proteinase K for 2 hrs at 60 °C with 300 rpm and was subsequently purified by using QIAquick® Nucleotide Removal Kit (28306, Qiagen) according to the manufactory’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... log-phase cells in the range of 1–2 × 108 cells using the Qiagen DNeasy® Blood and Tissue kit (Qiagen). We resuspended the genomic DNA in 10 mM Tris-HCl pH 8.5 and stored it at 4° until submission to the McDonnell Genome Institute at Washington University in St ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 viriants S and point-mutated pseudovirus were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN, Cat#52906), and served as template for reverse transcription using the TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR reagent (TransGen Biotech ...
-
bioRxiv - Neuroscience 2022Quote: ... Complementary DNA (cDNA) was subsequently generated using 2 μg of total RNA and the miScript II Reverse Transcription (RT) Kit (Qiagen, Australia), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 μg of RNA was used to generate cDNA using the RT2 First Strand Kit (#330401, SABiosciences, a Qiagen Company). In a fluorescent temperature cycler ...
-
bioRxiv - Immunology 2022Quote: The total RNA was extracted from uninfected and SARS-CoV-2 infected mice lung tissue using RNeasy mini kit (QIAGEN #74104). The quantity of RNA was determined using Qubit RNA assay kit with Qubit 4.0 and the quality of RNA was tested using agarose gel electrophoresis and High Sensitivity Tape station Kit (Agilent 2200 ...
-
bioRxiv - Neuroscience 2023Quote: ... After protein digestion (PK Buffer and Proteinase K (20 mg/mL) for 2 hrs at 45°C) DNA was purified with QIAquick PCR Purification Kit (Qiagen, Germany) according to manufacturer instruction ...
-
bioRxiv - Cancer Biology 2023Quote: DNA was extracted from NCI-PC35-1 and NCI-PC35-2 organoids using an AllPrep DNA/RNA Mini Kit (Qiagen 80204) according to the manufacturer’s protocol for animal cells ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA fragment of interest was excised from a 2% agarose gel and purified with QIAquick Gel Extraction Kit (Qiagen Inc.). The NEBNext Ultra DNA Library Prep Kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNA thus obtained was diluted to 2 ng/µl and specific target miRNAs were amplified by qPCR using the miRCURY LNA SYBR Green PCR kit (Qiagen, 339346). Expression of all targets was normalised against the expression of two reference genes (SNORD48 and U6 ...
-
bioRxiv - Immunology 2023Quote: ... in vitro derived Foxp3+ cells were harvested on day 2 and day 6 into Trizol and total RNA was isolated with miRNeasy Micro Kits (QIAGEN 217084) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was extracted from each 2 g of bulk and rhizosphere soils of the pepper plants using a RNeasy PowerSoil Total RNA Kit (Qiagen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cancer Biology 2022Quote: ... and protein extraction were performed according to manufacturer instructions (AllPrep DNA/RNA/Protein minikit; Qiagen). Each spin column flowthrough (DNA ...
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged proteins were purified using the QIAexpress Ni-NTA Protein Purification System (Qiagen) with 0.1 M ...
-
bioRxiv - Neuroscience 2022Quote: PCR with forward and reverse primers (see Table 1) was performed on mouse hypothalamic cDNA (isolated with miRNeasy Mini Kit, Qiagen, Hilden, Germany). PCR products were ligated into pGEMT.easy (Promega ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA and miRNA fractions were isolated from the mouse frozen tissue with the miRNeasy Micro Kit protocol (Qiagen, Toronto, ON, Canada). All RNA samples were determined to have 260/280 and 260/230 values ≥1.8 ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNAs from mouse tumors were extracted and purified using the RNeasy Mini Kit and RNase-free DNase Set (QIAGEN, Valencia, CA) following the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: DNA was isolated from tail biopsies using the Gentra Puregene Mouse Tail Kit according to the manufacturer’s instructions (Qiagen, Valenica, CA, USA). Genomic DNA was digested with BamHI-HF (New England Biolabs ...
-
bioRxiv - Neuroscience 2019Quote: ... Total RNA and miRNA fractions were isolated from the mouse frozen tissue with the miRNeasy Micro Kit protocol (Qiagen, Toronto, ON, Canada). All RNA samples were determined to have 260/280 and 260/230 values ≥1.8 ...
-
bioRxiv - Microbiology 2021Quote: ... Total genomic DNA was extracted from each ked lysate and blood (camel, mouse, and rabbit) using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was isolated from the tail tip of a wild-type C57BL/6J mouse using the DNEasy Blood and Tissue Kit (Qiagen, Hilden, Germany). The genomic C-terminal region of OGT was amplified using the Q5 Hot Start High Fidelity 2x master mix (New England Biolabs) ...
-
bioRxiv - Immunology 2023Quote: Total cellular RNA was extracted from mouse placental tissues or HTR8 cells using a RNeasy Plus Mini Kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNAs from mouse tumors were extracted and purified using the RNeasy Mini Kit and RNase-free DNase Set (QIAGEN, Valencia, CA) following the protocol provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from blood-free cranial lobes of the right mouse lung using the RNeasy Tissue Mini Kit (Qiagen, Hombrechtikon, Switzerland). Isolated RNA was reverse-transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics ...
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was purified from the blood of a transfer mouse using the Qiagen QIAamp DNA Blood Kit (Qiagen, Cat# 51106), and genotyping PCR was performed to assess integration into the target locus ...
-
bioRxiv - Neuroscience 2023Quote: ... The left hippocampus was homogenized on ice in the lysis buffer from the AllPrep® DNA/RNA/Protein Mini Kit (QIAGEN, Hilden, Germany). A sample from the lysate was used to quantify total DNA and RNA content using the appropriate Qubit® Fluorometer kit (Cat ...
-
bioRxiv - Immunology 2021Quote: ... RNA from each Xenopus embryo (n=2-3/condition) was separately extracted and purified using the RNeasy Micro Kit (Qiagen; Venlo, Netherlands) and microarray measurements were performed using the GeneChip Xenopus laevis Genome 2.0 Array (Affymetrix ...
-
bioRxiv - Physiology 2019Quote: Total RNA was prepared by lysing cell pellets (2×106) in 700 μl Qiazol and extracted using Qiagen miRNeasy mini kit according to the manufacturer’s recommendation (Qiagen Inc, CA, USA) from the same samples (n=54) ...
-
bioRxiv - Genomics 2019Quote: ... Total RNA was isolated from whole blood (2.5mL) thawed at room temperature for 2 hours prior to using the PAXGene RNA extraction kit (Qiagen, Chatsworth, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 2 μg/lane which gave the best separation was scaled up for extraction using QIAquick Gel Extraction Kit (Qiagen cat# 28704).
-
bioRxiv - Genetics 2021Quote: ... and 200-500 bp fragments were extracted from a 2% agarose gel after electrophoresis and purified using a Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany). The purified DNA was PCR amplified using 2× GoTaq Colorless Master Mix (Promega ...
-
bioRxiv - Immunology 2021Quote: ... The dried DNA pellet was reconstituted in 50 μL H2O treated with 330 μg/mL of RNase A for 2 hours at 37°C and then recovered using the QIAquick PCR Purification kit (QIAGEN Cat#28104). DNA concentration was determined by Qubit (Thermofisher).
-
bioRxiv - Microbiology 2020Quote: We evaluated the impact of using Nanotrap particles to capture and concentrate SARS-CoV-2 on several nucleic acid extraction methods: the QIAamp® Viral RNA Mini Kit from QIAGEN (52906); the RNeasy® Mini Kit from QIAGEN (74106) ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA was extracted from 1-to 2-mm-long tail tips using the DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). Genomic DNA (5 μl ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from root tips (~2 mm) in three biological replicates for each genotype using RNeasy plant mini kit (QIAGEN, http://www.qiagen.com). Approximately 300 root tips from 6-days-old plants were collected for each sample ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 21 and 28 days post inoculation (dpi) and 2 μg was used to synthesize cDNA using the QuantiTect® Reverse Transcription Kit (Qiagen, CAD) following the manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Ligated DNA fragments ranging in size from 300 to 450 base pairs (bp) were extracted from 2% low-melt agarose gels and purified using a MinElute gel extraction kit (Qiagen, Valencia, CA). The recovered fragments were amplified using PCR ...
-
bioRxiv - Genetics 2021Quote: ... in length were extracted from a 2% agarose gel after electrophoresis and purified using a Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany). The purified DNA was PCR amplified using GoTaq Colorless Master Mix (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... The qPCR was performed using the TaqMan™ RNA-to-CT™ 1-Step kit (Thermo Fischer Scientific) and was run in a RotorGene-6000-2-plex (Qiagen). PCR conditions having reverse transcription at 48’C for 15 min ...
-
bioRxiv - Genomics 2020Quote: ... Realtime-qPCR was performed on 11 differentially expressed (DE) miRNAs based on miRNA-seq results (|FC| ≥ 2, P < 0.05) using miScript SYBR Green PCR Kit (Qiagen 218073, California, USA) according to the manufacturer’s instructions with StepOne Applied Biosystems real-time PCR machine (Applied Biosystems ...