Labshake search
Citations for Qiagen :
851 - 900 of 1234 citations for Lysozyme C LYZ Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: Genomic DNA was extracted immediately upon UV-C exposure (time point 0) using the Plant DNA Extraction kit (Qiagen). Five µg of genomic DNA were sonicated (Diagenode Bioruptor ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... The solution was further cleared at 20,000 × g at 4 °C and the supernatant was incubated with Ni-NTA resin (Qiagen) for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were expressed in BL21de3 E.coli by auto induction in LB medium at 18°C and purified using Ni-NTA beads (Qiagen). When present ...
-
bioRxiv - Microbiology 2020Quote: ... at 37°C and genomic DNA was extracted using the Qiagen DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA). The concentration of resultant DNA was determined using a Qubit double-stranded DNA BR assay kit and a Qubit fluorometer (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... total RNA was extracted from the frozen mite samples (−80°C) using the RNeasy Plus Mini Kit (Qiagen, Belgium) according to the manufacturer’s Quick-Start Protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The aqueous phase was separated by centrifugation at 13,000 g at 4°C and RNA was purified using the RNeasy Mini Kit (Qiagen) with on-column DNAse digestion ...
-
bioRxiv - Immunology 2022Quote: ... Lysate was cleared from debris by centrifugation at 30,000 g and 4°C for 30 min before being loaded onto a Ni-NTA Superflow cartridge (Qiagen) using an Äkta Explorer chromatography system (GE Healthcare) ...
-
bioRxiv - Biochemistry 2023Quote: ... The lysate was cleared by centrifugation at 10,000g for 30 min at 4 °C and applied to 15-mL equilibrated Ni-NTA beads (Qiagen). The Ni-NTA column was washed with 150 mL of buffer B (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... This was followed by three washes with 2X SSC at 37°C and treatment with RNaseA (200ng/ml; Qiagen) in 2X SSC at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Cell lysate was cleared by centrifugation at 100,000 × g for 30 min at 4 ⁰C and then incubated with Ni2+-NTA agarose beads (Qiagen) for 30 min at 4⁰C ...
-
bioRxiv - Immunology 2023Quote: ... 40mM Tris-HCl ph 6.5 for 2 hour at 45°C prior to purification with QIAquick PCR Purification Kit (Qiagen). For ‘input’ DNA ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted (3,000 g, 15 min, 4°C) and total RNA was isolated using the miRNeasy Mini Kit (QIAGEN) in combination with the RNase-Free DNase Set (QIAGEN) ...
-
bioRxiv - Biochemistry 2023Quote: ... The lysate was cleared by centrifugation at 10,000g for 30 min at 4 °C and applied to 15-mL equilibrated Ni-NTA beads (Qiagen). The Ni-NTA column was washed with 150 mL of buffer B (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2022Quote: ... The tagmentation reaction mixture was transferred in a 1.5ml low-binding tube and incubated at 37°C for 30 min and stopped by the addition of 250μl Buffer PB (Qiagen). The tagmented chromatin was purified using the MinElute PCR purification kit (Qiagen 28004) ...
-
bioRxiv - Genomics 2023Quote: ... Transposition reaction was incubated at 37°C for 30 min and purified using the PCR purification MinElute Kit (QIAGEN), according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... for 10 minutes at 37°C followed by a final clean-up with Qiagen RNeasy MinElute Kit (Qiagen, #74204) using default manufacturer’s protocol (which keeps RNAs > 200nt ...
-
bioRxiv - Microbiology 2023Quote: ... 37 °C) of strain GFKo1 grown in nutrient broth (Oxoid) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen). Extracted DNA was adjusted to a concentration of 0.2 ng/μL and treated using the Nextera XT DNA library preparation kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... cholerae N16961 cultures grown in LB at 37°C in both exponential (OD600 0,8) and stationary (OD600 2,8) growth phases using the RNeasy® Mini Kit (QIAGEN), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was 0.2 µM filtered and was incubated overnight at 4°C with 5 mL of Ni-NTA beads (Qiagen). XXX
-
bioRxiv - Microbiology 2023Quote: ... cholerae WT and ΔSI cultures grown in LB at 37°C in both exponential (OD600 0,8) and stationary (OD600 2,8) growth phases using the RNeasy® Mini Kit (QIAGEN), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The soluble lysates obtained after two rounds of centrifugation at 18,000g and 4°C were incubated with glutathione agarose beads (Pierce) or Ni2+-NTA beads (QIAGEN). Recombinant proteins were eluted from the beads using 10 mM reduced glutathione in a Tris (50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1h at 37 °C (2 units per sample) followed by purification with the RNeasy miniElute Cleanup kit (Qiagen).
-
Altered motility in response to iron-limitation is regulated by lpdA in uropathogenic E. coli CFT073bioRxiv - Microbiology 2023Quote: ... Strains were cultured for five hours at 37°C with aeration before harvest and treatment with bacterial RNAprotect (Qiagen). Bacterial pellets were stored at -80°C until RNA isolation.
-
bioRxiv - Genomics 2024Quote: ... 72 °C for 1 min and then subjected to a 1.2x SPRI cleanup eluting in 42 µl EB buffer (Qiagen). Each sample was split into two fractions and each of them was further amplified with modality-specific primers ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µl NEB2 buffer and 0.1 U enzyme were incubated 15 min 30°C and purified from unincorporated nucleotides using Nucleotide Removal Kit (Qiagen). Binding reactions were carried out in a total volume of 10 µl ...
-
bioRxiv - Microbiology 2024Quote: ... Flag-SHOC2 was cleaved from 6X-His-MBP by incubating 37 mg purified protein with 0.65 mg TEV protease at 4°C overnight followed by affinity purification using Nickel affinity resin (Qiagen) where cleaved Flag-SHOC2 was collected in the flow-through.
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Microbiology 2023Quote: ... All samples were stored at -80°C until the DNA was extracted using the DNeasy PowerSoil Pro Kit (Qiagen). A blank DNA extraction was included to account for possible contaminations ...
-
bioRxiv - Microbiology 2024Quote: ... Lysates were clarified by centrifugation at 21,000× g at 4°C and loaded onto gravity flow Ni-NTA agarose columns (Qiagen), followed by washing with 50 mM HEPES pH 7.5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lysates were further transferred to liquid N2/ -80 °C freezer before RNA purification according to Qiagen protocol (www.Qiagen.com ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR array for human cell cycle (Cat#PAHS-020Z) and oncogenes and tumor suppressor genes (Cat#PAHS-502Z) was purchased from Qiagen (Valencia, CA, USA), and was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from the mouse cells/tissues and human cell lines using the RNeasy® Mini Kit (Qiagen Inc., Germantown, MD). For human platelets and MEG-01 cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... To profile the expression of genes related to p53-mediated signal transduction based on the RT² Profiler™ PCR Array Human p53 Signaling Pathway (#330231, PAHS-027ZC, Qiagen, Hilden, Germany), reverse transcription and qPCR were performed using the RT2 First Strand Kit (#330401 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were harvested by centrifugation at 4°C followed by cell lysis/RNA extraction using RNEasy plus mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysate [1μg/μL] was RNase A digested at 37°C for 15 min following addition of 1 μg RNase A (Qiagen) per 25 μg protein ...
-
bioRxiv - Cancer Biology 2021Quote: ... Inoculants from glycerol stocks or stab culture were cultured overnight in liquid LB at 37°C and plasmids were extracted using Plasmid miniprep kit (Qiagen). See Key Resources Table for shRNA identity ...
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was further digested with TURBO DNase overnight at 37°C (10 U per 2 μg of RNA) and purified with the RNeasy MinElute Cleanup Kit (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Developmental Biology 2021Quote: ... The samples were incubated at 37 °C for 16 hours overnight and were in turn cleaned-up using the QIAquick PCR Purification kit (QIAGEN) and eluted with 40 μl of 50 °C water ...
-
bioRxiv - Genetics 2020Quote: ... Ligation was carried out overnight at 16°C followed by overnight cross-link removal with 20mg/ml Proteinase K (Qiagen). The samples were purified using phenol-chloroform and ethanol precipitated resulting in 3C libraries ...
-
bioRxiv - Microbiology 2019Quote: ... snap frozen on dry ice and stored at −80°C until RNA purification with the Qiagen AllPrep RNA/DNA kit (Qiagen). Immunoglobulin amplicon preparation ...
-
bioRxiv - Genomics 2020Quote: ... 25ng of the purified product was subjected to self-ligation at 16 °C overnight in a total volume of 50uls and column purified using Qiagen (Qiagen) PCR purification kit as per manufacturers recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Five colonies with the correct sized insert were inoculated into liquid LB supplemented with spectinomycin and chloramphenicol and grown overnight at 37°C for plasmid extraction using a QIAprep Spin Miniprep Kit (Qiagen). The plasmid constructs were confirmed by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets were resuspended in lysis buffer and stored at -80°C before DNA or total RNA extraction with the Genomic DNA Mini (Blood/Culture Cell) (Genesis) or mRNAeasy (Qiagen) kits ...
-
bioRxiv - Biophysics 2022Quote: ... Purified protein was diluted in PBS buffer (pH = 7.2) and the fluorescence intensity was recorded at 60 °C in the Rotor-Gene 6600 real-time PCR cycler (Qiagen) for 18 h ...
-
bioRxiv - Genomics 2019Quote: ... with the addition of 20 μl of proteinase K (20 mg/ml) followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.) ...