Labshake search
Citations for Qiagen :
851 - 900 of 1256 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... centrifuged to 300 xG for 3 mins and dissociated using RLT buffer as recommended by RNeasy Plus Mini Kit (74134, Qiagen). All RNA isolation steps were done as recommended by the RNeasy kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting 1683 bp product spanning the 3’ end of MYO2 upstream of the integration site through the 3’ untranslated region was then isolated using a PCR purification kit (Qiagen), and mutations were confirmed by sequencing using primer 5’- CTCATTTGTGGTGTTTGCTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... BioConcept) in TAE buffer (3-07F03-I, BioConcept) and products were extracted using the QIAquick Gel Extraction Kit (28706, Qiagen) and Sanger sequenced by Microsynth (Balgach ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial cells were harvested from the surface of the cheese agar by using a sterile razor blade and were then immediately placed into 3 mL of RNAProtect Bacteria Reagent (Qiagen) and frozen at -80C until RNA extraction ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2024Quote: ... was added to each tube and homogenized at 30 rev/s for 3 minutes for 2 rounds using a tissue homogenizer/lyser (#9003240, Qiagen). Kidney extracts were centrifuged at 17,000 RCF for 10 minutes and the supernatant was transferred to a 1.5 mL microcentrifuge tube and kept over ice for 1-2h ...
-
bioRxiv - Pathology 2024Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Genetics 2024Quote: RNA was isolated from 10 wandering third-instar larvae (3 biological replicates per genotype; WT, pr-set720 and parp-1C03256) using RNeasy lipid tissue mini kit (Qiagen). RNA samples were flash-frozen in liquid nitrogen and sent to Novogene for library preparation and sequencing ...
-
bioRxiv - Genomics 2024Quote: DNA was extracted from approximately 3 ml of whole blood using the Gentra Puregene Blood Kits (#158467; Qiagen, Hilden, Germany), following the “Whole Blood” subsection in the manufacturer-provided handbook ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final samples of 3 or 30 million cells were collected and genomic DNA was extracted (DNeasy blood and Tissue kit, Qiagen). Next ...
-
bioRxiv - Genetics 2024Quote: ... yeast plasmid DNA was extracted from 5x107 cells harvested off of galactose and final glucose plates of replicates 2 and 3 using Qiaprep Spin Miniprep Kit (QIAGEN). We amplified the 200-bp repair template region from the initial E ...
-
bioRxiv - Plant Biology 2024Quote: ... roots or cotyledons) of 3 DAG Arabidopsis seedlings was flash frozen in liquid nitrogen and powdered with TissueLyser machine (Qiagen). RNA was isolated with TRIzol (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: To determine bispecificity of bsAbs his-tagged HCV E2 (3 μg/mL in Tris-buffered saline (TBS)) was immobilized on NiNTA 96-well plates (Qiagen) for 2h at RT ...
-
bioRxiv - Immunology 2024Quote: Reverse transcription and PCR I were performed in 384-well plates pre-loaded with 3 µL of Vapor-Lock (Qiagen). Cell lysis buffer and reverse transcriptase mix (0.4 µL/well ...
-
bioRxiv - Biochemistry 2024Quote: ... NEO1 3’UTR was isolated from genomic DNA isolated from cultured HEK-293T using DNeasy Blood and Tissue kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting homogenates were centrifuged at 13,000 rotations per minute (rpm) for 3 min and RNA in the supernatant was purified using the RNase Mini Kit (Qiagen). A NanoDrop spectrophotometer was used to measure the concentration of RNA in each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were diluted in TE buffer and treated with 1 μL of 20 mg/mL RNAse A (Applichem) for 1 h and 3 μL of Proteinase K (Qiagen) for 2 h at 40C ...
-
bioRxiv - Molecular Biology 2024Quote: ... ligated with a single-stranded phosphorylated oligo (to create a 3’-end overhang on template strand) and purified using PCR purification kit (Qiagen). Sequences are listed in Table S1 ...
-
bioRxiv - Cell Biology 2024Quote: ... SF was transfected with 12.5 nM antisense LNA GapmeRs CBP (Qiagen, Sequence: 5′-GCG GCG ATC CTT TAG A-3′) or p300 (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... plasmids containing spacer sequences were isolated from 3 mL of overnight culture from each sample with a QIAprep Spin Miniprep Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Genomic DNA was extracted from 3 mm rings surrounding the initial punch wound using DNeasy Blood and Tissue kit (Qiagen). The tissues from a pair of ear pinnae from each animal were pooled prior to DNA extraction so that each DNA sample represented one mouse ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from 5,000 sorted melanocytes from 3-4 control or ID1-overexpressing fish per stage using RNeasy Micro Kit (Qiagen, 74004). Ultralow input RNA-seq was performed using the SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Clontech ...
-
bioRxiv - Biophysics 2024Quote: ... 1.0 mL of culture was extracted from each tube and mixed with 3 mL of RNAprotect Bacteria reagent (Qiagen, Germany) to stabilize cellular RNA ...
-
bioRxiv - Immunology 2020Quote: ... The clarified supernatant containing the target protein was incubated with pre-equilibrated Ni-NTA resin (Qiagen) for 30 min at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membranes before being revealed with anti-Histidine monoclonal antibodies (Qiagen). Immune complexes were detected with anti-rabbit peroxidase-conjugated secondary antibodies (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: Proteins were purified from Sf21 insect cells by affinity purification with Ni-NTA agarose (Qiagen, 30230) and ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein purification was performed using Ni+2-NTA agarose affinity chromatography according to standard protocol (Qiagen).
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated from tumor samples using the AllPrep DNA/RNA/Protein Mini Kit (QIAGEN) according to standard protocol on the QiaCube (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... Insoluble material was removed by centrifugation and 6xHis-tagged protein was purified using Ni-NTA (Qiagen) and gravity chromatography ...
-
bioRxiv - Systems Biology 2021Quote: ... PBMCs were thawed on ice and then lysed to protein fraction using Allprep Spin Columns (Qiagen) according to the manufacturer’s instructions with the QIAshredder lysis option ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant containing hexahistidine-tagged proteins was passed over a column of Ni2+-NTA matrix (Qiagen) at 0.5 mL matrix / 1 L of culture ...
-
bioRxiv - Plant Biology 2021Quote: ... HIS-tagged proteins were purified by metal-affinity chromatography using Ni-NTA resins (Qiagen, Hilden, Germany). Protein concentration was estimated by the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
STARCH SYNTHASE 4 is required for normal starch granule initiation in amyloplasts of wheat endospermbioRxiv - Plant Biology 2021Quote: ... Denaturing purification of the protein with urea was carried out using the Ni-NTA Agarose (Qiagen). Immunisation of rabbits was carried out at Eurogentec ...
-
bioRxiv - Microbiology 2021Quote: ... The LuxT-6xHis protein was purified from the clarified supernatant by Ni-NTA Superflow resin (Qiagen). Following washes with lysis buffer containing 20 mM Imidazole ...
-
bioRxiv - Cancer Biology 2021Quote: ... washed again and proteins were visualized by SuperSignal™ West Dura Extended Duration Substrate (Qiagen #34076)
-
bioRxiv - Biochemistry 2022Quote: ... Protein extract was subjected to IMAC by incubation with 2 ml Ni-NTA resin (Qiagen, Germany) per 50 ml of extract ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The His6-tagged protein was purified by affinity chromatography on Ni-NTA agarose beads (Qiagen 30230) and cleaved on beads with TEV protease o/n at 4 °C ...
-
bioRxiv - Microbiology 2022Quote: ... The protein sequences were aligned by MUSCLE [76] and visualized by CLC Genomic Workbench 8.5.1 (Qiagen). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... Protein expression was performed using standard protocols and purification was performed using Ni-NTA Agarose (Qiagen). Recombinant RelMtb protein (87 kDa ...
-
bioRxiv - Synthetic Biology 2021Quote: 6His-tagged Mdb1 recombinant protein was expressed in BL21 and purified using Ni-NTA beads (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... The His-tagged target protein was purified by Ni-NTA gravity-flow chromatography (Qiagen, Hilden, Germany). The eluted protein was subjected to MonoQ 10/100 GL (GE Healthcare Lifesciences ...
-
bioRxiv - Molecular Biology 2023Quote: ... proteins identified from proteomics were mapped to existing biological networks by Ingenuity Pathway Analysis (QIAGEN, CA)
-
bioRxiv - Neuroscience 2022Quote: Extraction of total DNA and RNA was performed using the Allprep DNA/RNA/Protein kit (Qiagen) according to the manufacturers protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated according to the manufacturer’s instructions (AllPrep DNA/RNA/Protein Mini, Qiagen, Austin, Texas). RNA quality was determined using an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fusion protein in the lysate was affinity-purified by Ni-NTA agarose beads (Qiagen, 30210) capturing HIS tag or by glutathione sepharose 4B beads (Amersham ...
-
bioRxiv - Immunology 2024Quote: ANKRD55 interactome proteins were analyzed with the use of Ingenuity Pathway Analysis (IPA) software from QIAGEN (https://digitalinsights.qiagen.com/IPA) ...
-
bioRxiv - Neuroscience 2023Quote: ... The protein was then purified on Ni-NTA affinity chromatography with Ni-NTA agarose resin (Qiagen) following the protocol described in Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatant containing each target protein was loaded onto a Ni-NTA (nitrilotriacetic acid) column (Qiagen) which was pre-equilibrated with the corresponding Lysis Buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 500 mM KCl and fusion proteins were purified from clarified lysate through consecutive Ni-NTA (Qiagen) and HiTrap Q HP (GE Healthcare ...