Labshake search
Citations for Qiagen :
801 - 850 of 10000+ citations for Mouse Bcl 2 Modifying Factor BMF ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a 48-sample holder (Tissue Lyser 2, Qiagen). The samples were treated with 1 ml pre-cooled (-20°C ...
-
bioRxiv - Microbiology 2023Quote: ... fitted with a 2 ml tube holder (Qiagen, Germantown, MD). RNA was purified with the ZymoBIOMICS RNA Miniprep kit (R2001 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Pellets were thawed in 2 mL RLT lysis buffer (Qiagen) containing 10 μL mL-1 of 2-mercaptoethanol ...
-
bioRxiv - Physiology 2024Quote: ... The supernatant was incubated with 2 mL Ni-NTA (Qiagen) for 1 hour at 4°C with gentle mixing ...
-
bioRxiv - Physiology 2019Quote: ... Total RNA from mouse islets was extracted using RNeasy microkit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... mouse placenta tissue was homogenized using the Qiagen TissueLyser II (Qiagen) with 5 mm beads in RLT buffer (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... and cDNA was used on the mouse osteogenesis (Qiagen, PAMM 026ZR) and WNT signaling targets PCR array (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... was from List Biological Laboratories and the mouse monoclonal antibody against the His-tag from Qiagen.
-
bioRxiv - Cell Biology 2022Quote: RNA from mouse islets were harvested using the RNeasy Microkit (QIAGEN) and cDNA synthesized using iScript (BioRad ...
-
bioRxiv - Genetics 2022Quote: ... Fresh frozen mouse tissues were homogenised in buffer RLT plus (Qiagen) with β-mercaptoethanol (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mouse aorta was homogenized by TissueLyser II (Qiagen, Venlo, Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RT2 Profiler PCR Array Mouse p53 Signaling Pathway (PAMM-027Z – Qiagen) was used for quantification ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was harvested from mouse ear skin using TissueLyser II (Qiagen) and TRIzol (Life Technologies ...
-
bioRxiv - Genomics 2021Quote: ... DNeasy Blood & Tissue Kit and QIAamp DNA FFPE Tissue Kit (Qiagen) were used for Genomic DNA extraction of paired FF and FFPE samples respectively.
-
bioRxiv - Genomics 2021Quote: ... These kits included QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany), Plasma/Serum Cell-Free Circulating DNA Purification Mini Kit (Norgen Biotek ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Plasmid Midiprep kit and Maxi kit were from QIAGEN (Valencia, CA). The 1,4-dioxane ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was synthesized using the KIT Quantitec Transcription KIT (QIAGEN) as recommended by the manufacturer ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA was extracted with kits from QIAGEN (MagAttract HMW kit) and MACHEREY-NAGEL (Nucleospin Tissue Kit) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sodium bisulfite treatment was carried out using commercially available bisulfite conversion kits (EpiTect Fast Bisulfite Kit and EpiTect Fast LyseAll Bisulfite Kit; Qiagen) according to the manufacturer’s instructions except for the DNA denaturation step and sodium bisulfite reaction time ...
-
bioRxiv - Microbiology 2024Quote: ... and the genomic DNA/RNA extractions were conducted using commercial extraction kits (DNeasy Blood & Tissue Kit for DNA or RNeasy Mini Kit for RNA, both from Qiagen) and purified with GeneJET Genomic DNA Purification Kit (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... to perform RT² Profiler™ PCR Array Mouse Hypoxia Signaling Pathway (Qiagen) real-time PCR in Stratagene MX3000p qPCR system under these cycling conditions ...
-
bioRxiv - Genetics 2021Quote: ... Hrh1 amplicons from each mouse strain were gel purified (Qiagen Cat# 28115) and DNA sequencing reactions were performed with the BigDye terminator cycle sequencing kit (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against 3’UTR sequence of mouse Alr were purchased from Qiagen. siRNAs were transfected into HEK293 or MEF using Dharmafect 1 Transfection Reagent (Dharmacon) ...
-
bioRxiv - Molecular Biology 2022Quote: ... were transfected into mouse calvarial osteoblasts using the Effectene transfection reagent (Qiagen). After 48 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tag ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse penta-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Immunology 2019Quote: ... The following mouse primer sets were used from Qiagen (Valencia, CA, USA): TBP (PPM03560F ...
-
bioRxiv - Cell Biology 2021Quote: siRNA for mouse VHL (Flexitube Gene Solution GS22346) was obtained from Qiagen. AllStars negative control siRNA ...
-
bioRxiv - Immunology 2020Quote: A RT2 profiler array for mouse inflammatory cytokines and receptors (Qiagen, USA) was used according to manufacturer recommendations to measure the expression of 84 inflammatory genes (Table S1) ...
-
bioRxiv - Microbiology 2022Quote: ... and immunoblotted using a mouse monoclonal antibody against Strep-tag (Qiagen, 34850). Alkaline phosphatase conjugated to anti-mouse IgG (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Mouse antibody genes were amplified using HotstarTaq DNA polymerase (Qiagen Cat # 203209) with the primer sets specific for the IghIOMAiGL and IgkIOMAiGL transgenes ...
-
bioRxiv - Biochemistry 2023Quote: ... and mouse anti-Phospho-Serine Q5 (catalogue number: 37430) was from Qiagen. Horseradish peroxidase-conjugated secondary antibodies against rabbit (catalogue number ...
-
bioRxiv - Biochemistry 2023Quote: ... a conjugate of mouse monoclonal penta-His antibody and horseradish peroxidase (Qiagen) was used ...
-
bioRxiv - Genetics 2023Quote: Mouse tissues were either homogenized using QIAzol lysis reagent (Qiagen, Hilden, Germany) in a Tissue Lyser instrument (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... A mouse Yy1-specific siRNA or the AllStars Negative Control siRNA (Qiagen) was co-transfected with an L1 promoter reporter plasmid using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...