Labshake search
Citations for Qiagen :
651 - 700 of 10000+ citations for Mouse Bcl 2 Modifying Factor BMF ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Bacterial DNA in the mouse fecal samples and GI content (200 mg) was extracted using QIAamp® PowerFecal® Pro DNA kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Genomics 2020Quote: ... 80 µl of Viral Transport Media that had previously stored a nasopharyngeal swab from a patient infected with SARS-CoV-2 were used for RNA isolation using the QIAamp Viral RNA Mini spin kit (Qiagen, Cat No./ID: 52904) according to manufacturer specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... Both the input and IP samples were incubated at 50°C for 2 hr and then cleaned up using the Qiaquick PCR Purification Kit (Qiagen, Hilden, Germany, Cat # 28104) and eluted in 35 μL of water.
-
bioRxiv - Systems Biology 2019Quote: RNA was extracted from a total of 17 samples from Experiment 2 with the AllPrep PowerFecal DNA/RNA Kit (Qiagen USA, Cat. No. 80244). The 17 samples included 7 target samples taken during antibiotic treatment (4 untreated and 3 non-responder ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted from the remaining 2 mL of the cell suspension using the RNeasy® Protect Bacteria Mini Kit (QIAGEN, Cat. No. 74524) following the manufacturer instructions.
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was isolated from bulk HSPC samples (∼2 x 106 cells per sample) using a QIAGEN Blood & Tissue DNA isolation kit (QIAGEN, Inc., Germantown, MD, USA) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA from mouse forelimb buds and bamboo shark pectoral fin buds was extracted with the RNeasy Micro and Mini plus kit (QIAGEN, Cat. No. 74034 and 74134). Genomic DNA was removed with gDNA Eliminator columns included with this kit ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Physiology 2019Quote: ... as well as mouse Tbp (Quantitect, Qiagen) as a housekeeping gene.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
bioRxiv - Microbiology 2022Quote: ... the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse XpressRef Universal Total RNA (QIAgen, 338114) was reverse transcribed and used at a concentration of 250 ng cDNA per reaction as a positive control for each primer set ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Genomics 2021Quote: Amplicon libraries for viral genome sequencing were prepared using QIAseq FX DNA Library Kit and QIAseq SARS-CoV-2 Primer Panel (Qiagen, cat. no. 180475, cat. no. 333896) as instructed by the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2020Quote: ... a monoclonal mouse Strep-tag antibodies (#34850, Qiagen), a monoclonal anti-actin antibody (A5441 ...
-
bioRxiv - Cell Biology 2023Quote: ... or siRNA for Anxa2 (Mouse, Qiagen, Mm_Anxa2_3, SI00167496).
-
bioRxiv - Biochemistry 2023Quote: Mouse EL4 genomic DNA was isolated by QIAGEN Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse tissues were homogenized using TissueLyser II (Qiagen) and stainless-steel beads (5 mm ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...