Labshake search
Citations for Qiagen :
801 - 850 of 6341 citations for Dengue Virus Serotype 3 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The RBD protein was purified by affinity chromatography using Ni-NTA resin (QIAGEN), followed by size exclusion chromatography on a HiLoad Superdex 200 pg column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2021Quote: ... The soluble recombinant protein was purified using theNickel-Nitrilotriacetic acid (Ni-NTA+; Qiagen) resin ...
-
bioRxiv - Cell Biology 2021Quote: ... The protein interaction network analysis was performed using QIAGEN’S Ingenuity Pathways Analysis (QIAGEN’S Ingenuity pathway analysis ...
-
bioRxiv - Bioengineering 2022Quote: ... Purification of all proteins was performed using a Ni-NTA agarose column (Qiagen). After washing with buffer A containing 30 mM imidazole ...
-
bioRxiv - Immunology 2022Quote: ... The cleaved protein was passed over a 1 mL Ni-NTA agarose (Qiagen) gravity column to remove TEV protease ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Proteins were extracted from frozen mouse left ventricles using the TissueLyser LT (Qiagen) with 5mm stainless steel beads (69989 ...
-
bioRxiv - Plant Biology 2022Quote: ... Target protein was recovered and purified with a His-Trap affinity column (QIAGEN) according to manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2023Quote: The eluted protein was mixed with 1 ml Strep-Tactin Superflow agarose (Qiagen) and incubated at 4 °C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Preparation of his-tagged recombinant proteins was performed according to manufacturer instructions (Qiagen). Preparation of GST-tagged recombinant proteins was performed according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The protein was purified under non-denaturing conditions using Ni-NTA resin (Qiagen) at 4 °C according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The protein was isolated from the lysate using Ni-NTA Agarose resin (Qiagen) and was purified to homogeneity and >95% purity by size exclusion chromatography using a HiLoad Superdex 75 pg 16/600 column (Cytiva ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were purified through metal-affinity chromatography using Ni2+–NTA agarose beads (Qiagen). Purified protein aliquots were stored at -30°C in 50 mM Tris-Cl ...
-
bioRxiv - Cancer Biology 2023Quote: ... all proteins were purified using Ni-NTA (nickel-nitrilotriacetic acid) resin from QIAGEN. After the incubation of Expi293 media supernatant with the Ni-NTA resin ...
-
bioRxiv - Cell Biology 2023Quote: ... The proteins were first purified using nickel-nitrilotriacetic acid (NTA) agarose resin (Qiagen), and the His8-SUMO tag was then removed by TEV protease (10:1 w/w ...
-
bioRxiv - Physiology 2023Quote: ... Tissues were then lysed in protein isolation buffer using a tissue-lyser (Qiagen). Protein concentration was measured by Bradford assay ...
-
bioRxiv - Biophysics 2023Quote: ... His6-MBP-HNRNPH2 proteins were first purified using Ni-NTA Agarose (#30230, Qiagen) and eluted with buffer containing 250 mM imidazole pH 7.8 (#79227 ...
-
bioRxiv - Cancer Biology 2022Quote: ... EV and protein fractions using miRNeasy serum/plasma kit (Qiagen 1071073 Lot#160020206) after adding 1.0×10^6 copies/µL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035) ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Nickel sepharose according to the manufacturer’s instructions (QIAGEN). The purified recombinant protein was dialyzed overnight against dialysis buffer (20 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... The recombinant TDP-43 proteins were purified over Ni-NTA agarose beads (Qiagen) and eluted using 50 mM HEPES (pH 7.5) ...
-
bioRxiv - Bioengineering 2024Quote: ... Each His-tagged protein in media was captured with Ni-NTA resin (Qiagen) and eluted with DPBS containing 150 mM imidazole.
-
bioRxiv - Microbiology 2023Quote: ... All nucleotide and protein sequences were analyzed using CLC Main Workbench 8.1.2 (Qiagen).
-
bioRxiv - Cancer Biology 2023Quote: SAINT Express protein hits were analyzed using Ingenuity Pathway Analysis (IPA) software (Qiagen). Significant hits were analyzed and enrichment z-score was calculated for different pathways ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were purified by immobilized metal affinity chromatography using Ni–NTA agarose (Qiagen) pre-equilibrated with lysis buffer in individual Econo-Pac gravity-flow columns (Bio-Rad) ...
-
bioRxiv - Neuroscience 2023Quote: Protein pathway analysis was conducted on DEP using Ingenuity Pathway Analysis (IPA, Qiagen) and Gene Ontology (GO ...
-
bioRxiv - Microbiology 2024Quote: ... The fusion protein was affinity purified using Ni-NTA agarose (Qiagen; Table S4), eluted with 50 mM Tris-base ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated from 3 months old Pgrcre and FOXL2OE diestrus uteri using RNeasy mini kit (Qiagen). The library was prepared using TruSeq RNA Library Prep kit (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... beat-beading tubes were filled 1/3 with beads and soaked overnight in 500 μl buffer RLT (Qiagen). Tubes were spun at full speed and excess buffer removed ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-day-old seedlings using a QIAshredder and RNeasy Plus Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 1000 µL PBS was added to each sample (lungs, 0.01–0.04 g) along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized at a speed of 10 Hz for 10 min and then centrifuged at 15,000 × g for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples were then ground to powder using a 3 mm tungsten carbide bead (Qiagen Cat. No. / ID: 69997) on a TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... homogenized in sterile 0.05 % NP40 in H2O for 3 minutes at 25 Hz using a Tissue Lyzer (Qiagen) and serial dilutions were plated on YPD agar containing 100 μg/ml Ampicillin ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were transfected at 3 DIV with siRNA targeting Kdm6a or ntRNA using Effectene Transfection Reagent (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 500 µl of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized during 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Developmental Biology 2020Quote: ... benthamiana leaves were grinded in a tube with two glass beads (3 mm) with a TissueLyser II (Qiagen) and directly after supplied with 600 μl EB ...
-
bioRxiv - Microbiology 2019Quote: ... RNA samples from 3 independent cultures for each strain (Chr_dam and Chr_gfp) were extracted with RNeasy miniprep kit (Qiagen). Primers used are listed in Table S1 ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed 3 times with PBS and had their genomic DNA extracted with the QIAamp DNA mini kit (QIAGEN). Sequencing libraries were prepared at GenomeScan (Netherlands ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 0 or 3% CSE-treated bronchospheres using the Qiagen RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Microbiology 2023Quote: ... Individual mosquitoes were homogenized for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). DNA extraction of individual larvae was carried out using the QIAamp DNA Kit (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...