Labshake search
Citations for Qiagen :
1051 - 1100 of 6341 citations for Dengue Virus Serotype 3 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Cells were lysed in 3% SDS in 10mM Tris pH = 7.5 by pipetting then centrifuge through a Qiashredder column (Qiagen #79656). Protein concentrations were determined by BCA assay (Thermo Fisher Scientific #23225) ...
-
bioRxiv - Microbiology 2023Quote: ... fresh 0.35 g/L proteinase K) during two rounds of 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). Total RNA was converted into complementary DNA (cDNA ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 µg DNA ratio using effectene transfection reagent (Qiagen). Recombinant ...
-
bioRxiv - Genomics 2023Quote: ... 1µM Template-Switching Oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” prefixes a ribonucleic acid base and “+” prefixes a locked nucleic acid base, Qiagen) then incubated using a ThermoMixer C with the following conditions ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Genetics 2022Quote: RNA from cortex and hippocampus derived ex vivo cultures was extracted from 3 biological replicates for three time points (DIV3, DIV15, DIV31) using RNeasy Plus Mini Kit (Qiagen). cDNA was synthesized using a SuperScript IV Reverse Transcriptase cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... centrifuged to 300 xG for 3 mins and dissociated using RLT buffer as recommended by RNeasy Plus Mini Kit (74134, Qiagen). All RNA isolation steps were done as recommended by the RNeasy kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting 1683 bp product spanning the 3’ end of MYO2 upstream of the integration site through the 3’ untranslated region was then isolated using a PCR purification kit (Qiagen), and mutations were confirmed by sequencing using primer 5’- CTCATTTGTGGTGTTTGCTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... BioConcept) in TAE buffer (3-07F03-I, BioConcept) and products were extracted using the QIAquick Gel Extraction Kit (28706, Qiagen) and Sanger sequenced by Microsynth (Balgach ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial cells were harvested from the surface of the cheese agar by using a sterile razor blade and were then immediately placed into 3 mL of RNAProtect Bacteria Reagent (Qiagen) and frozen at -80C until RNA extraction ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2023Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... and Chl523R (5’ CCY YMC GTA TTA CCG CAG CT 3’) targeting the 16S rRNA gene on a QIAcuity One digital PCR device (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Genomics 2023Quote: DNA was extracted from approximately 3 ml of whole blood using the Gentra Puregene Blood Kits (#158467; Qiagen, Hilden, Germany), following the “Whole Blood” subsection in the manufacturer-provided handbook ...
-
bioRxiv - Molecular Biology 2023Quote: ... the FT and Eluate fractions (90 µL each) were mixed with 10 µL 3 M sodium acetate and applied to a QIAquick spin column (Qiagen). Purified DNA was visualized a 1.3% agarose / 0.5x TBE gel and SYBR Green staining ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Microbiology 2023Quote: ... tissues were placed in 300μL of sterile PBS containing sterile glass beads and mechanically lysed at a frequency of 20 shakes per seconds for 3 minutes in a TissueLyser II (Qiagen). Negative controls consisted of tubes containing PBS and beads but no sample ...
-
bioRxiv - Genetics 2023Quote: RNA was isolated from 10 wandering third-instar larvae (3 biological replicates per genotype; WT, PR-Set720 and Parp1C03256) using RNeasy lipid tissue mini kit (Qiagen). RNA samples were flash-frozen in liquid nitrogen and sent to Novogene for library preparation and sequencing ...
-
bioRxiv - Genetics 2023Quote: Total RNA was isolated from 10 third-instar larvae for each biological replicate (3) using an RNeasy Lipid Tissue Mini kit (Qiagen). DNA contamination was removed using TURBO DNA-free (Ambion) ...
-
bioRxiv - Microbiology 2023Quote: DNA extraction was carried out with 37 mg of freeze-dried mycelium using the Nucleospin Microbial DNA kit in combination with 3 mm tungsten carbide beads (Qiagen) for tissue disruption in a MM 301 vibratory mill ...
-
bioRxiv - Cell Biology 2023Quote: Cells were cultured on a glass substrate and soft hydrogel for 3 days and total RNA was extracted using RNeasy mini kit (Qiagen). RNA quantity and purity were verified using 2200 TapeStation system (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2024Quote: Genomic DNA was isolated from ipsilateral and contralateral ventral midbrain hemispheres at 3 months after AAV-GFP or AAV-Cre-GFP injections using the DNeasy Blood and Tissue kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... mosquitoes were homogenized in 500 μl ice-cold 1X Phosphate Buffered Saline buffer with two ice-cold steel bearing balls (3 mm diameter, LOUDET) using a TissueLyser II (Qiagen) and clarified through centrifugation ...
-
bioRxiv - Bioengineering 2024Quote: Total RNA was isolated from untreated or RNP-transfected plerixafor-mobilized HD and SCD HSPCs (n=3 for each group) using the RNeasy Kit (QIAGEN) that includes a DNAse treatment step ...
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were FACS-sorted for mCherry+ cells directly into RNA-stabilizing cell lysis buffer (Qiagen Buffer RLT). Homogenization was performed on QiaShredder columns ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA from cells in Qiagen Cell Lysis were purified using Qiagen Puregene Cell Kit (Qiagen 158722) according to manufacturer’s instructions and resuspended in 100µl nuclease-free H20 ...
-
bioRxiv - Immunology 2020Quote: Cells were resuspended and stored in RNAprotect cell reagent (Qiagen). RNA was extracted with the RNeasy mini kit (Qiagen ...
-
bioRxiv - Bioengineering 2023Quote: ... Single-cell suspensions were depleted of red blood cells (Qiagen) before downstream use.
-
bioRxiv - Immunology 2020Quote: ... The clarified supernatant containing the target protein was incubated with pre-equilibrated Ni-NTA resin (Qiagen) for 30 min at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membranes before being revealed with anti-Histidine monoclonal antibodies (Qiagen). Immune complexes were detected with anti-rabbit peroxidase-conjugated secondary antibodies (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein purification was performed using Ni+2-NTA agarose affinity chromatography according to standard protocol (Qiagen).
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated from tumor samples using the AllPrep DNA/RNA/Protein Mini Kit (QIAGEN) according to standard protocol on the QiaCube (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... Insoluble material was removed by centrifugation and 6xHis-tagged protein was purified using Ni-NTA (Qiagen) and gravity chromatography ...
-
bioRxiv - Systems Biology 2021Quote: ... PBMCs were thawed on ice and then lysed to protein fraction using Allprep Spin Columns (Qiagen) according to the manufacturer’s instructions with the QIAshredder lysis option ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant containing hexahistidine-tagged proteins was passed over a column of Ni2+-NTA matrix (Qiagen) at 0.5 mL matrix / 1 L of culture ...
-
bioRxiv - Plant Biology 2021Quote: ... HIS-tagged proteins were purified by metal-affinity chromatography using Ni-NTA resins (Qiagen, Hilden, Germany). Protein concentration was estimated by the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
STARCH SYNTHASE 4 is required for normal starch granule initiation in amyloplasts of wheat endospermbioRxiv - Plant Biology 2021Quote: ... Denaturing purification of the protein with urea was carried out using the Ni-NTA Agarose (Qiagen). Immunisation of rabbits was carried out at Eurogentec ...
-
bioRxiv - Microbiology 2021Quote: ... The LuxT-6xHis protein was purified from the clarified supernatant by Ni-NTA Superflow resin (Qiagen). Following washes with lysis buffer containing 20 mM Imidazole ...
-
bioRxiv - Cancer Biology 2021Quote: ... washed again and proteins were visualized by SuperSignal™ West Dura Extended Duration Substrate (Qiagen #34076)
-
bioRxiv - Biochemistry 2022Quote: ... Protein extract was subjected to IMAC by incubation with 2 ml Ni-NTA resin (Qiagen, Germany) per 50 ml of extract ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The His6-tagged protein was purified by affinity chromatography on Ni-NTA agarose beads (Qiagen 30230) and cleaved on beads with TEV protease o/n at 4 °C ...
-
bioRxiv - Microbiology 2022Quote: ... The protein sequences were aligned by MUSCLE [76] and visualized by CLC Genomic Workbench 8.5.1 (Qiagen). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... Protein expression was performed using standard protocols and purification was performed using Ni-NTA Agarose (Qiagen). Recombinant RelMtb protein (87 kDa ...
-
bioRxiv - Plant Biology 2019Quote: ... The protein was purified under denaturing conditions on Ni2+-nitrilotriacetic acid matrix (Ni-NTA Agarose, Qiagen) and used to raise polyclonal antibody in rabbits (Eurogentec) ...
-
bioRxiv - Synthetic Biology 2021Quote: 6His-tagged Mdb1 recombinant protein was expressed in BL21 and purified using Ni-NTA beads (Qiagen) following manufacturer’s instructions ...