Labshake search
Citations for Qiagen :
801 - 850 of 3702 citations for 7 PHENYL 1 2 4 TRIAZOLO 1 5 A PYRIMIDINE 6 CARBONITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... samples were shaken for 1 min in a TissueLyser II (Qiagen) and then centrifuged at 4ºC for 5 min at maximum speed in a tabletop microfuge ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% NP-40) and immediately placed in “RTL plus” buffer (Qiagen). The mRNA was purified using the RNase micro KIT (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 µl whole blood was homogenised in 1 ml QIAzol (Qiagen) using a TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... then transferred to 1 ml RNAprotect Tissue Reagent (Qiagen, Hilden, Germany) for colonic transcript analyses ...
-
bioRxiv - Physiology 2023Quote: ... The tissue lysates were treated with 1% DNase (Qiagen, Hilden, Germany) and diluted to a protein concentration of 10μg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... plus 1% ꞵ-mercaptoethanol and homogenized using a QIAshredder column (QIAGEN). RNA was extracted using the RNeasy Mini kit (QIAGEN) ...
-
bioRxiv - Cell Biology 2023Quote: ... This fragment (fragment 1) was gel-purified (QIAquick DNA cleanup, Qiagen) to remove any residual plasmid and contain only a linear template.
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from Caki-1 cells using the RNeasy (Qiagen) kit according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... at room temperature for 1 hour and Proteinase K (Qiagen 158918) at 55°C for 2 hours followed by a reverse cross-link at 65°C overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mL of washed Ni-NTA beads (Qiagen catalog no. 30210) were added for each 50 mg of total ubiquitin in the reaction ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 colonies using a DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). We used DNeasy Blood & Tissue Kits (QIAGEN ...
-
bioRxiv - Genomics 2023Quote: ... 1% SDS and 0.6 mg/mL Proteinase K (Qiagen, cat#19131) and 0.4 mg/mL RNaseA (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant was loaded onto a 1 ml StrepTactin column (Qiagen) at a flow rate of 0.7 ml/min in the ÄKTA prime-plus liquid chromatography system (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the mixture was incubated with 1 mL Ni-NTA (Qiagen) beads at 4 ºC for 1 h to remove TEV protease ...
-
bioRxiv - Molecular Biology 2024Quote: ... the remaining wash buffer was removed and 1 ml QIAzol (Qiagen) was added to the beads and incubated at RT for 10 min ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 mL of 50% Ni-NTA agarose (Qiagen, Toronto, Ontario, Canada) was equilibrated using 10 bed volumes of wash buffer (same formulation as lysis buffer) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase Inhibitor (4 unit/µl) (cat # 1055213, Qiagen), rRNasin Rnase inhibitor (40 U/µl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4) DNeasy Plant Mini Kit (QIAGEN®) combined with the InhibitEx Buffer step from the QIAamp DNA Stool Mini Kit to improve inhibitor removal ...
-
bioRxiv - Microbiology 2019Quote: ... 4 µg/mL DNase I (QIAgen, Hilden, Germany), 2 µg/mL RNase A (QIAgen) ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of 100 mg/mL RNase (Qiagen) was added ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 μL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stainless steel 5 mm beads (Qiagen, Germany) were additionally sterilised by heating at 220°C for 3 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5 mm stainless steel beads (Qiagen) at 30 Hz for 3 min at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 mm stainless steel beads (Qiagen) for 4 minutes at 24,000 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...