Labshake search
Citations for Qiagen :
751 - 800 of 2092 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized with random hexamers using an Omniscript RT Kit (Qiagen). cDNA was quantified using TaqMan gene expression probes (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... Synthesis of cDNA was performed with RNeasy Microarray Tissue Mini Kit (QIAGEN), using 1μg of total RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Synthesis of cDNA was carried out using an Omniscript RT kit (Qiagen) with 100 ng total RNA per reaction ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized from 250ng RNA using QuantiTect Reverse Transcription Kit (Qiagen), and qRT-PCR reactions were performed with SYBR Green reagent (Roche ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesised and PCR amplified with Onestep RT-PCR kit (Qiagen). Ighv alleles were amplified using a common variable region primer msVHE (5’GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG3’ ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA synthesis was carried out using the RT2 first stand kit (Qiagen) cDNA synthesis kit following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Ligated cDNA was gel purified with the MinElute gel purification kit (Qiagen), PCR amplified ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from extracted RNA using RT2 First Strand Kit (Qiagen) or High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... 2μg was utilised for cDNA synthesis using the Omniscript RT kit (Qiagen). Quantitative PCR was carried out using previously described specific primers and probes and normalized to 18S rRNA housekeeping gene ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA was then purified using a MinElute PCR Purification Kit (QIAGEN), and libraries were prepared as for DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA was synthesized using Quantic Reverse Transcription kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA transcripts were quantified by Rotor Gene Real-Time PCR System (Qiagen) using SYBR Green (Biorad) ...
-
bioRxiv - Genetics 2023Quote: ... and then converted to cDNA using the miRCURY LNA RT Kit (Qiagen). The samples with total exosomal RNA and cDNA were stored in a freezer at −80℃ ...
-
bioRxiv - Neuroscience 2023Quote: cDNA synthesis was performed using the miScript II RT Kit (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2023Quote: ... cDNAs were purified by a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and complementary strands synthesised by Klenow DNA polymerase I ...
-
bioRxiv - Microbiology 2022Quote: ... Complimentary DNA was made using High-Capacity cDNA Reverse Transcription kit (Qiagen). qPCR reactions were carried out using iQ SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cDNA library was purified using the MinElute PCR purification kit (Qiagen) and amplified using Q5 Host-Start High-Fidelity 2x Master Mix (New England Biolabs) ...
-
bioRxiv - Bioengineering 2022Quote: ... cDNAs were inserted in the pQE80 expression plasmid (Qiagen, Valencia, California, USA) using BamHI and BglII restriction enzymes ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA samples were prepared using the Quantitect reverse transcription kit (Qiagen, 205311). QPCR was then performed with the SYBR Green master mix (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was then cleaned up using a MinElute Reaction CleanUp Kit (Qiagen). To reduce adaptor dimers ...
-
bioRxiv - Microbiology 2023Quote: ... and reverse-transcribed to generate cDNA using QuantiTect Reverse Transcription system (Qiagen). Primers for real-time RT PCR (F ...
-
bioRxiv - Genomics 2024Quote: ... was used to synthesise cDNA and miRCURY LNA RT Kit (Qiagen, UK) was used to perform qPCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Retro-transcription into cDNA was performed using QuantiTect Reverse Transcription kit (Qiagen).
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was purified with a QIAEX II Gel Extraction Kit (Qiagen #20021) as follows ...
-
bioRxiv - Microbiology 2023Quote: PCR on cDNA was performed using the fast-cycling PCR kit (Qiagen). Primer sequences are listed in Table S6.
-
bioRxiv - Microbiology 2023Quote: ... The synthesized cDNA was purified using a QIAquick PCR purification kit (Qiagen), and its concentration was determined spectrophotometrically in a Nano-drop Lite spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... before reverse transcription into cDNA using QuantiTect Reverse Transcription Kit (Qiagen, Germany). qPCR was performed with PowerTrackTM SYBR Green Master Mix kit (ThermoFisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cDNA was synthesized using the QuantiTech Reverse Transcription Kit (Qiagen 205311) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized with the QuantiTect Reverse Transcription kit (Qiagen, Cat. 205314). Gene expression was determined using SYBR Green (GC biotech ...
-
bioRxiv - Neuroscience 2022Quote: ... and cDNA was obtained using the QuantiTect® Reverse Transcription Kit (Qiagen) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was prepared using QIAGEN’s RT2 First Strand Kit (QIAGEN, Hilden, Germany). RT-PCR was performed using QIAGEN’s RT2 Profiler™ PCR Array Human Cell Death PathwayFinder (QIAGEN ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from RNA extraction via RNeasy plant mini kit (Qiagen) and SuperScript III reverse transcriptase (ThermoFisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA synthesis was performed using the RT2 first strand kit (Qiagen, UK) and following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... was converted to cDNA with the QuantiTect Reverse Transcription Kit (Qiagen, 205313) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was converted to cDNA by QuantiTect Reverse Transcription Kit (Qiagen #205311). For muTECs ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized using a QuantiTect reverse transcription kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was then cleaned up using a MinElute Reaction CleanUp Kit (Qiagen). To reduce adaptor dimers ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was reverse transcribed from 0.35ug RNA with OmniScript Reverse Transcriptase (Qiagen), diluted 1:10 ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was synthesized using the QuantiTect Reverse Transcription Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA synthesis was carried out using the QuantiTect Reverse Transcriptase Kit (Qiagen) following the manufactures guidelines.
-
bioRxiv - Neuroscience 2024Quote: ... RNA was converted to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... cDNAs were purified by a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and complementary strands synthesised by Klenow DNA polymerase I ...
-
bioRxiv - Molecular Biology 2024Quote: ... and cDNA synthesis was conducted with the QuantiTect Reverse Transcription Kit (Qiagen), following the manufacturer’s protocols.
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA synthesis was performed with the QuantiTect Reverse Transcription Kit (Qiagen, #205313), and qRT-PCR reactions were run with the HOT FIREPol SolisGreen qPCR Mix reagent (Solis BioDyne ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA synthesis was done using the QuantiTect Reverse Transcription Kit (Qiagen, 205311). Real-time PCR was done on a starting material of 15 ng of cDNA with SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cDNA was synthesized from RNA using miRCURY LNA RT Kit (339340, QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was reverse transcribed using QuantiTect Reverse Transcription kit (Qiagen, MD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... The cDNA was then purified using the QIAquick PCR Purification Kit (Qiagen) and eluted with EB buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... complementary DNA (cDNA) was synthesized using the Quantitect Reverse Transcription kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA synthesis was performed by using the QuantiTect Reverse Transcription Kit (QIAGEN), according to the manufacturer’s instructions ...