Labshake search
Citations for Qiagen :
1001 - 1050 of 2092 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... First strand cDNA synthesis was carried out using the QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... each RNA sample was converted to cDNA using QuantiTect Reverse Transcriptase kit (Qiagen, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... The generated cDNA products were gel purified using Qiaquick Gel Extraction kit (Qiagen, #28704) and sent for sequencing.
-
bioRxiv - Cell Biology 2022Quote: The cDNA for qRT experiments was prepared with miScript II RT kit (Qiagen, 218161) using HiFlex buffer ...
-
bioRxiv - Microbiology 2022Quote: ... and converted to cDNA using a QuantiTect® Reverse Transcription Kit (QIAGEN, Hilden, Germany). qRT-PCR of VL30 and γ-RVV mRNA was premised on the same primer/probe sets that were described above ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was first reverse-transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from the total RNA with the RT2 First Strand Kit (Qiagen), with an additional DNase I treatment step ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesised from 1g total RNA using the QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The total RNA was reverse transcribed into cDNA with miScript II RT Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... was used for first-strand cDNA synthesis using QuantiTect Reverse Transcription kit (QIAGEN, Germany) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: cDNA was synthesized from ≤ 1µg RNA using the QuantiTect Reverse Transcription Kit (Qiagen, 205311), snap-frozen and stored at −80 °C until further use ...
-
bioRxiv - Bioengineering 2020Quote: ... SYBR Green dye was used to target synthesized cDNA (Quantifast SYBR Green I, Qiagen). Real-time PCR was then performed (7500 Real Time PCR system ...
-
bioRxiv - Cell Biology 2022Quote: ... 1µg of RNA was converted to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative real time PCR reactions were performed with cDNA using iTaq Universal SYBR Green supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was reverse transcribed and converted into cDNA using RT2 first strand Kit (QIAGEN). The cDNA was then diluted with nuclease-free water and added to the RT2 qPCR SYBR green Master Mix (SA Biosciences ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated using the QuantiTect reverse transcription kit with gDNA Wipeout (Qiagen, DE). Conventional PCR amplification of Gpr116 was achieved using the forward primer 5’ TCCAATTCGAGGGACCGAAG 3’ and reverse primer 5’ GTAGTTCACAACCACGCTGC 3’ ...
-
bioRxiv - Bioengineering 2020Quote: ... SYBR Green dye was used to target synthesized cDNA (Quantifast SYBR Green I, Qiagen). Real time PCR was then performed (7500 Real Time PCR system ...
-
bioRxiv - Genomics 2021Quote: cDNA was generated from 5μg of Human XpressRef Universal Total RNA (Qiagen cat # 338112) using Superscript III Reverse Transcriptase (Invitrogen cat # 18080093 ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNAs were synthesized from ∼1 µg total RNA using QuantiTect Reverse Transcription kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2020Quote: ... The first strand cDNA was synthesized using Omniscript Reverse Transcriptase Kit (Qiagen Inc., Canada) and Oligo-dT primers (Integrated DNA Technologies ...
-
bioRxiv - Bioengineering 2020Quote: ... and RNA was reverse-transcribed to cDNA using a QuantiTect Reverse Transcription kit (Qiagen) and a S100 thermal cycler (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: cDNA was synthesized from the total RNA with the RT2 First Strand Kit (Qiagen), Superscript VILO IV (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA was further purified and concentrated by using QIAquick PCR Purification Kit (Qiagen) and the concentration was determined by Nanodrop ND-1000 instrument ...
-
bioRxiv - Biochemistry 2020Quote: ... Cellular RNA was isolated and converted to cDNA using RNAeasy RNA extraction kit (Qiagen) and Quantitect Reverse-transcriptase kit (Qiagen ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... All cDNA segments were extracted using a Qiaquick Gel Extraction kit (Qiagen, Valencia, CA), subcloned in Bluescript SK (Stratagene ...
-
bioRxiv - Cancer Biology 2021Quote: ... Then the cDNA fragments were purified with QiaQuick PCR extraction kit (Qiagen, The Netherlands), end-repaired ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA of WCR midgut was synthesized by Omniscript RT kit (Qiagen, Germantown, MD). To validate the pattern of AS ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using the QuantiTect RT kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The RNA was reverse transcribed to cDNA with the Quantitect Reverse Transcription kit (Qiagen). Gene expression analysis was performed with primer assays from Qiagen [IL-10] and Eurofins [IL-12α ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized from 500 ng of RNA using Quantitect Reverse Transcriptase kits (Qiagen). Transcriptomic analysis was performed using the GeneChip WT PLUS Reagent kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesised from 500 ng RNA using the miScript II RT kit (Qiagen) with HiFlex buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA (500 ng) was reverse transcribed into cDNA using QuantiTect RT-PCR kit (Qiagen). RT-PCR was performed on a BioRad CFX384 thermocycler using pre-validated Taqman primers (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... and cDNA was synthesized using the miScript II RT Kit (Qiagen, 218160, California, USA) following the manufacturer’s instructions and stored at −80°C until use ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was obtained by reverse transcription using the QuantiTect Reverse Transcription kit (Qiagen; #205311) and real-time qPCR was performed using the SYBR Green labeling method (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: RNA of cells was transcribed to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen): 50-1000 ng RNA were mixed with RNAse-free water and gDNA Wipeout buffer for 2 min at 42°C ...
-
bioRxiv - Bioengineering 2023Quote: ... before reverse transcribing to cDNA with the QuantiTect Reverse Transcription kit (Qiagen, Hilden, Germany). All cDNA samples were diluted with PCR-grade ultrapure water to 12.5 ng/µL prior to qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplification of cDNA was performed using the Quantitect SYBR Green PCR Kit (Qiagen). Formation of PCR products was monitored in real time using the CFX96 Touch Real-Time PCR Detection System (BioRad) ...
-
bioRxiv - Plant Biology 2023Quote: ... DNase treatment and cDNA synthesis was carried out using QuantiTect Reverse Transcription Kit (Qiagen). Expression of PIF4 and ARP6 was analyzed by semiqunatitative PCR and qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was synthesized from 500 ng of RNA using QuantiTect Reverse Transcription Kit (Qiagen). Quantitative real-time PCR was performed using Select Master Mix (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) synthesis was performed using the QuantiTect Reverse Transcription Kit (205313, Qiagen). qRT-PCR was performed on a QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... Equal quantities of RNA were transcribed into cDNA using QuantiTect Reverse Transcription kits (Qiagen), and analysis of targets gene expression was performed on a 7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized from 500 ng of RNA using Quantitect Reverse Transcriptase kits (Qiagen) and qPCR was performed using perfeCTa SYBR green fastmix (Quanta Bioscience ...
-
bioRxiv - Microbiology 2024Quote: ... this was reverse transcribed to cDNA using the Quantitect Reverse Transcription Kit (Qiagen, Germany). To obtain a more complete library ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was prepared from 1 µg of RNA using QuantiNova Reverse Transcription Kit (Qiagen). SYBR Green I Master (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... which was then reverse transcribed into cDNA using the reverse transcriptase Omniscript (Qiagen, Germany) and oligo(dT ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was generated from total RNA using the miRCURY LNA RT Kit (QIAGEN, 339340) and then amplified in duplicate by qPCR using the miRCURY LNA SYBR Green PCR Kit (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... 12 µL were reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen), as described elsewhere (14) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cDNA was reverse-transcribed from total RNA using Omniscript® reverse transcriptase (QIAGEN). The expression levels of TWD1 were determined via qRT–PCR using the SYBR Green mix ...
-
bioRxiv - Developmental Biology 2022Quote: ... Reverse transcription for cDNA synthesis was performed using M-MuLV Reverse Transcriptase (Enzymatics, Qiagen) and RNAse Inhibitor (Biotechrabbit) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... cDNA was synthesized from 500ng of total RNA using the Omniscript RT-Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Complementary DNA (cDNA) synthesis was performed using the QuantiTect Reverse Transcription Kit (Qiagen, #205313). Quantitative PCR (qPCR ...