Labshake search
Citations for Qiagen :
751 - 800 of 3847 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Total DNA (including integrated HIV-1 DNA and episomal HIV-1 DNA) was extracted using the QIAmp blood DNA minikit (Qiagen, Courtaboeuf, France) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... washed with 1 ml RNAprotect® Cell Reagent (Qiagen) and centrifuged for 10 min at 2,500 x g ...
-
bioRxiv - Genetics 2019Quote: ... and mouse anti-Strep (Qiagen Cat# 34850, 1:500) with goat or donkey secondary antibodies from Jackson ImmunoResearch used 1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 µl zymolyase and 1 mg/ul RNase (QIAGEN). This was incubated in a 37 °C shaker for 1 hour before the addition of Proteinase K (10 µl ...
-
bioRxiv - Physiology 2021Quote: 1 μg purified extracted RNA (RNeasy Mini Kit, Qiagen) was reverse transcribed using qScript Reverse Transcriptase (Quanta Biosciences ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of proteinase K (20 mg/mL, Qiagen) was added and samples were incubated at RT for 10 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... mAb anti-His6 (34650; IF: 1/500) from Qiagen, mAb anti-GAPDH (GTX28245 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the His-tag (1:1000, Qiagen), rabbit antibodies against the C-terminal region of the collagen VI α1 chain (1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reaction conditions were 1 × HotStar® Taq buffer (Qiagen) supplemented with 1.6 mM MgCl2 ...
-
bioRxiv - Microbiology 2019Quote: ... resuspended in 1 mL RTL buffer (Qiagen RNeasy Kit) and lysed by bead beating (2 × 1 min ...
-
bioRxiv - Neuroscience 2021Quote: ... and diluted 1:50 in TE-Buffer (Qiagen, #1018499) to a final concentration of 1.75e12 vg/ml (kindly donated by I ...
-
bioRxiv - Immunology 2020Quote: ... HIV-1 RNA was isolated using the QIAcube (Qiagen) from mouse plasma using the QIAamp MinElute Virus Spin Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... 1:1,000 dilution of α-His-HRP antiserum (Qiagen), or 1:1,000 dilution of α-OmpA antiserum (Antibody Research Corporation ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 U HotStar Taq (Qiagen; based on polymerization activity), and 32 U FEN1 (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... After adding 1 ml of buffer PB (QIAGEN recipe), the samples were purified using QIAquick spin columns (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... combined with 1:10 (v/v) proteinase K (Qiagen) treatment ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 mL of Qiazol lysis reagent (Qiagen, #79306) and homogenized for 2 x 3 minutes ...
-
bioRxiv - Genomics 2024Quote: ... whilst immersed in 1 mL QIAzol Lysis Reagent (QIAGEN). The resulting lysate was then made up to 3 mL with QIAzol Lysis Reagent and mixed thoroughly before 1 mL lysate aliquots were processed using RNeasy Lipid Tissue Kit 74804 (QIAGEN ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA (1 μg) was treated with DNaseI (Qiagen). cDNA was generated using M-MLV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... treated with 1 mL of RNAprotect Bacteria Reagent (Qiagen), and pellets were stored at −80°C until RNA isolation ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mL of Ni-NTA agarose resin (Qiagen, Germany) is packed onto a propylene chromatography/cartridge column (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4C (Qiagen, SI05163977), and 20 nM HIF1A Flexitube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4B (Qiagen, SI00449764), 5 nM siKDM4C (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... 5 mM Multiplex-Kit (Qiagen) and HPLC water to a total volume of 10 μL per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 uL EB buffer (QIAGEN) was added to each well and mixed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μl RLT (79216, Qiagen) was added ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from the gut samples (7-10 guts/sample) using the RNeasy Mini kit (Qiagen) and the on-column DNase I treatment (79254 ...
-
bioRxiv - Biochemistry 2021Quote: ... supernatant was harvested after 7 days of expression and incubated with 300 μL of Ni-NTA resin (Qiagen) at 4°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was extracted from seedlings 7 dpg using the RNeasy Plant RNA Extraction kit (Qiagen Ltd., Surrey, UK). RT-PCR was performed using the OneStep RT-PCR kit (Qiagen ...
-
bioRxiv - Bioengineering 2022Quote: Tissue samples at day 0 and 7 were collected from devices and dissociated in the lysis buffer (Qiagen) by agitating with an electronic pestle for 1 min ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... Transfection into C2C12 or MCF-7 cells utilized a lipid-based reagent (Fast-forward protocol, Effectene reagent, Qiagen). As a reference for transfection efficiency ...
-
bioRxiv - Plant Biology 2023Quote: ... The grinding was done using 7 mm stainless steel beads with TissueLyser II bead mill (Qiagen, Hilden, Germany), 2 minutes totally at 25 Hz ...
-
bioRxiv - Immunology 2023Quote: ... cytometry-sorted 7-AAD- CD45+CD11b+F4/80+ cells were lysed in 350µL RLT lysis buffer (Qiagen, 79216). At 4 days post injury ...
-
bioRxiv - Cancer Biology 2023Quote: ... Resuspend the cells in 10 ml of suspension buffer (10 mM EDTA pH8.0, 150 mM NaCl, 1% glycerol, Lysis blue (1×, from QIAGEN Plasmid Plus Midi Kit), RNase A (0.55 mg/ml) ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)