Labshake search
Citations for Qiagen :
701 - 750 of 3847 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Digested PCR fragments were ligated into the restricted vector at a 1:1 molar ratio using T4 DNA ligase and were purified using the MiniElute PCR purification kit (Qiagen). Purified ligated plasmids were electroporated into MegaX DH10B (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... fungal DNA was extracted independently from 1 mL of crude conidial suspensions (between 108 and 109 spores mL-1) using the DNeasy 96 Plant Kit (Qiagen) following the manufacturer’s instructions (Gautier et al. ...
-
bioRxiv - Microbiology 2023Quote: ... was added to the supernatant to give a final concentration of 1 mM and the resultant suspension was applied to a 1 ml Ni2+-NTA column (Qiagen). The resin was then washed sequentially with 10 ml of lysis buffer (without Triton X-100) ...
-
bioRxiv - Physiology 2024Quote: ... After chloroform incubation and centrifugation per manufacture instructions RNA-containing phase was diluted with 70% ethanol 1:1 and RNA isolation was performed using RNeasy Mini Kit (Qiagen). For tissues ...
-
bioRxiv - Microbiology 2021Quote: ... 5-plex (Qiagen, Germany), the QIAcuity One-Step Viral RT-PCR Kit (Cat No ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5 μM TSO (Qiagen). Amplification of cDNA (22 amplification cycles ...
-
bioRxiv - Genomics 2020Quote: ... and 0.5 mg.ml-1 of Proteinase K (Qiagen), to reverse formaldehyde crosslinking ...
-
bioRxiv - Microbiology 2019Quote: ... 1 ml RLT buffer (Qiagen RNA Isolation Kit) + 10 μl β-mercaptoethanol was added and vortexed and a phenol chloroform extraction followed by an ethanol precipitation was carried out ...
-
bioRxiv - Microbiology 2021Quote: ... and 1-5mL Qiazol Lysis Reagent (Qiagen, #79306) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... amplification grade (1 U/µg RNA, Qiagen, #79254). Real-time qPCR was performed with a MyiQ™ instrument (BIO-RAD) ...
-
bioRxiv - Biochemistry 2022Quote: ... Penta-His Antibody (Qiagen, 34660, IB: 1:1000) and Y188 to APP C-terminus (Abcam ...
-
bioRxiv - Molecular Biology 2019Quote: ... with on-column DNase-1 digestion (79254, Qiagen). Purified RNA had 260/280 ratios ~2 (via Nanodrop 2000c ...
-
bioRxiv - Neuroscience 2019Quote: ... 5nmol of Rho-1 siRNA (Qiagen, Germany #SI01401743) was diluted in rnase-free water (provided in kit ...
-
bioRxiv - Biochemistry 2021Quote: ... passed over 1 mL Ni-NTA resin (Qiagen), and bound protein eluted with 10 CV of buffer A / 200 mM imidazole ...
-
bioRxiv - Genetics 2019Quote: ... 1× Type-it Multiplex PCR Master Mix (Qiagen), 0.2 μM of each locus specific reverse primers ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen, Hilden, Germany), and 0.2 μM of Primer_F3 and Primer_R (Figure S2 and Table S2) ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of buffer PB or PM (Qiagen), containing a high concentration of guanidine hydrochloride and isopropanol was added and mixed by pipetting ...
-
bioRxiv - Physiology 2022Quote: ... Samples were homogenized in 1 ml Qiazol (Qiagen) with 5 μl β-mercaptoethanol using a beadmill homogenizer cooled with liquid nitrogen and then phase separated using 1-bromo-3-chloropropane (BCP) ...
-
bioRxiv - Biophysics 2023Quote: ... Approximately 1 ml of Ni-NTA agarose (Qiagen) was utilised for purification of the lysate resulting from 1 l culture ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mL of RNA protect reagent (76506, Qiagen) was added to 500 µL of the sample ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 mL of ice-cold Qiazol (Qiagen, 79306) reagent was added and transferred into Precellys® lysing kit tubes (Keramik-kit 1.4/2.8 mm ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 9:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteinase K (20 μg·ml-1 final concentration, Qiagen) was firstly added to the relevant samples ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1% Protease Inhibitor using TissueLyser II (Qiagen) and 5 mm stainless steel beads (Qiagen ...
-
bioRxiv - Biochemistry 2024Quote: ... and anti-Strep (Qiagen, 34850, 1:1000 dilution) antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5×10^5 EpCAM+ve cells were lysed in 350μL RTL Buffer (Qiagen) containing 143mM β-Mercaptoethanol (aided by cell searing via passage ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
rpoB, a promising marker for analyzing the diversity of bacterial communities by amplicon sequencingbioRxiv - Microbiology 2019Quote: ... and were subjected to three cycles of grinding (1 minute, at 30 Hz followed by 1 minute without agitation) in a TissueLyser II apparatus (Qiagen, France). The solutions obtained from crushed nematodes or the contents of G ...
-
bioRxiv - Biochemistry 2019Quote: ... Bound STAT3 proteins were then labeled with Alexa488-conjugated anti-6 × His antibodies (1 hr incubation, 1:20 dilution, Qiagen 35310). The array was washed and scanned using a GenePix 4400A scanner (Molecular Devices ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted with 1 volume of 25:24:1 phenol-chloroform-isoamyl alcohol and purified with QIAquick PCR Purification Kit (QIAGEN 28104). Libraries were prepared with the Ovation Ultralow V2 DNA-Seq Library Preparation Kit (NuGEN (Redwood City ...
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated for 1 hour with monoclonal α-His antibodies conjugated to the horseradish peroxidase (1:5000 dilution; Qiagen). Blots were visualized with the addition of Lumina Forte Western HRP Substrate (MilliporeSigma ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2020Quote: Adrenal glands were homogenized in ammonium-bicarbonate buffer (150 mM ammonium bicarbonate, pH 7) with TissueLyser (Qiagen). Protein content was assessed using BCA Protein Assay Kit (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2021Quote: DNA was extracted from 0.5-7 mg biomass using DNeasy Powersoil microbial extraction kit (Qiagen, Hilden, Germany) accordingly to manufacturer’s instructions and stored at -20°C ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA was isolated from roots of 7-day-old seedlings using RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and 7 were isolated using a Plant RNeasy Mini kit with DNase I treatment (Qiagen, Hilden, Germany). Three biological replicates were prepared for each tissue type ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA from the MC.7.G5 clone was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and from blood by using either DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... along with the human NaV β1 and β2 subunits (2 μg total plasmid DNA was transfected with a cDNA ratio of 10:1:1 for NaV1.X:β1:β2 subunits) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.). Human β1 and β2 cDNAs were cloned into plasmids encoding the CD8 receptor (CD8-IRES-hβ1 ...
-
bioRxiv - Zoology 2019Quote: DNA was extracted from one individual pre-pupa that was pulled out from a cocoon sample (voucher # USDA-BRL 181221-03_G21; Fig 1-9 to 1-13) using the DNeasy Blood & Tissue Kit (Qiagen Inc., Valencia, CA), as per manufacturers protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transiently co-transfected with NaV1.2 and the accessory β1 and β2 subunits (2 μg total plasmid DNA was transfected with a cDNA ratio of 10:1:1 for NaV1.2:β1:β2 subunits) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.). Human β1 and β2 cDNAs were cloned into plasmids encoding the CD8 receptor (CD8-IRES-hβ1 ...
-
bioRxiv - Microbiology 2020Quote: Total RNA extraction was performed using a squash buffer (10 mM Tris base, 1 mM EDTA, 50 mM NaCl) supplemented with 1:8 part Proteinase K (Qiagen, 15mg/ml). Mosquito abdomens with the midguts and heads with thoraces were individually collected in 50 μl of squash buffer at 7 and 14 days ...