Labshake search
Citations for Qiagen :
751 - 800 of 1727 citations for 5 Isobutyl thiophene 2 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Alzheimer’s patient brain myeloid cells exhibit enhanced aging and unique transcriptional activationbioRxiv - Neuroscience 2019Quote: ... FACS-isolated cell populations were spun at 5,000 rcf for 5 minutes and resuspended in 0.35 ml Buffer RLT from Qiagen RNeasy Micro kit ...
-
bioRxiv - Cancer Biology 2019Quote: ... The reverse transcription step exactly followed SMART-seq2 protocol with 5’-biotinylated TSO (Qiagen, primers see Table S9). The first round of 24-cycle PCR started with 10µl reverse transcription product ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was isolated from 5 × 105 cells with the AllPrep© DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA for expression analyses was extracted from 5 day-old protonemata using a RNeasy Plant Mini Kit (Qiagen). Genomic DNA removal and cDNA synthesis were performed with a Quantitect Reverse Transcription kit (Qiagen).
-
bioRxiv - Developmental Biology 2021Quote: Log fold-change values of the top 5% proteins were used as input for Ingenuity Pathway Analysis (Qiagen: https://digitalinsights.qiagen.com/products/features/) ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from 5×106 cells per sample using the AllPrep DNA/RNA/miRNA Universal Kit (QIAGEN) according to manufacturer’s recommendations with additional DNase I treatment for RNA extraction ...
-
bioRxiv - Developmental Biology 2022Quote: ... Complementary DNA of microRNAs was synthesized from 5 μg total RNA using microRNA-specific primers (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Genomic DNA was eluted from the column using 5 mL of prewarmed (50°C) QF Buffer (Qiagen, Germany). DNA was precipitated by adding 0.7 volumes of isopropanol ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from the Sterivex filters (i.e., 0.22–5 μm size fraction) using an AllPrep DNA/RNA Mini Kit (80204; Qiagen) with a modified protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from 5-10 snap-frozen larvae with the RNeasy Mini kit (Qiagen cat no. 74104) and reverse-transcribed using QuantiTect Reverse Transcription kit (Qiagen cat no 205311 ...
-
bioRxiv - Immunology 2022Quote: Total RNA from ~ 5 × 105 neutrophils (CD45+Lin-CD11b+Ly6G+) was isolated with the RNeasy micro kit (Qiagen) and RNA quality was checked with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... A 5 ml aliquot of culture was removed and added to 10 ml of RNAprotect Bacteria Reagent (Qiagen) and mixed by vortexing ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Microbiology 2023Quote: ... Edmund Bühler) by bead beating twice for 5 min at 30 Hz in a Tissue Lyzer II (QIAGEN). Lysates were then incubated for 30 min at 37 °C with shaking ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA from 5-day-old whole plants was extracted using the RNeasy Plant Mini Kit (Qiagen, 74904). For RNA-seq ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...
-
bioRxiv - Physiology 2023Quote: ... a 5 mg piece of kidney tissue was homogenized in 350 μL of RNeasy RLT Lysis buffer (Qiagen) containing 2-mercaptoethanol and centrifuged at maximum speed for 3 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... Sequences with an E-value lower than 1e-5 were used for multiple sequence alignment using CLC v 21.0.5 sequence manager (Qiagen). After multiple rounds of alignments and manual removing non-nAChR sequences a set of 2047 proteins were obtained ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Biochemistry 2023Quote: ... High speed supernatant (HSS) was then batch bound to 5 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) resin at 4ºC for 2 hours stirring in a beaker ...
-
bioRxiv - Developmental Biology 2023Quote: ... Plates were then placed at 4 0C before adding the reverse transcription mix containing 5’-biotinylated TSO (Qiagen). PCR products were cleaned up using 0.8:1 Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2023Quote: ... Each of the wells that the nuclei were sorted into contained 5 uL of EB buffer (Qiagen, 19086), 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: RNA was extracted from 5 x 106 T cells using the RNeasy® Mini Kit (Qiagen, Cat. 74106). RNA extraction was performed following the instructions from the “Purification of Total RNA from Animal Cells Using Spin Technology” protocol given in the RNeasy® Mini Handbook ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Immunology 2023Quote: RNA was purified from at least 5 x 104 CD4+ T cells using the RNeasy Micro kit (Qiagen). cDNA was synthesized using the SuperScriptTMVILOTMcDNA synthesis kit (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Glycerol was added to the remaining culture to a final concentration of 15% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). The remaining 95 mL of culture was combined with 40.7 mL 50% glycerol (v/v) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were eluted using an imidazole gradient and subsequently loaded onto a 5 ml StrepTactin Superflow Cartridge (Qiagen) at a flow rate of 0.8 ml/min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR amplification was carried out in 5 µl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN, Germany). Each sample reaction contained 10–20 ng of genomic template DNA ...
-
bioRxiv - Cell Biology 2020Quote: All muscles were homogenized 2 × 30 sec at 30 Hz using a Tissuelyser II (Qiagen, USA) in ice-cold homogenization buffer (10% (v/v ...
-
bioRxiv - Plant Biology 2020Quote: Total DNA was isolated from 2-3 weeks old seedlings with DNeasy Plant Mini Kit (QIAGEN). 1ng of DNA per qPCR reaction was used as template ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg total RNA was used for cDNA synthesis using an Omniscript Reverse Transcription Kit (Qiagen). For the quantitative real-time PCR ...
-
bioRxiv - Microbiology 2021Quote: ... except that 2 mL prefilled PowerBead tubes (glass beads, 0.1 mm; Cat no. 13118-50, Qiagen) were used for the bead beating ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein purification was performed using Ni+2-NTA agarose affinity chromatography according to standard protocol (Qiagen).
-
bioRxiv - Cancer Biology 2019Quote: ... tumor samples (15-30 mg) were transferred to 2 ml round-bottom tubes (Qiagen, Hilden, Germany) with the addition of a 5 mm stainless steel bead (Qiagen ...
-
bioRxiv - Systems Biology 2020Quote: ... Cell pellets were transferred to 2 ml polypropylene tubes and disrupted using a TissueLyser II (Qiagen), adding the same volume of acid-washed glass beads (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: ... as per the manufacturer and a final elution step of 2×10 μL EB buffer (Qiagen).
-
bioRxiv - Genomics 2021Quote: ... counted and 2×104 were lysed in 100 µL of lysis buffer (RLT Plus (Qiagen, 1053393) and 1% ß-mercaptoethanol (Sigma-Aldrich,M3148)
-
bioRxiv - Microbiology 2021Quote: ... Tissues were homogenized at 30 Hz for 2 min using TissueLyser II (Qiagen GmbH, Hilden, Germany) and centrifuged for 30 sec at 11000 rpm ...
-
bioRxiv - Bioengineering 2020Quote: ... tissue clay and control hydrogels were homogenized for 2 minutes (TissueRuptor) in QIAzol lysis Reagant (Qiagen) and chloroform was added to precipitate and remove proteins ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR 2 products were purified by 1% agarose gel using a QIAquick Gel Extraction Kit (Qiagen), eluting with 15 μL of Elution Buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... and the resultant supernatant was mixed with 2 ml of Ni-NTA agarose resin suspension (Qiagen) and incubated on a rotary shaker for 60 min at 4°C before transfer to a Poly-Prep Chromatography Column (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... Frozen tissue was thawed and immediately homogenized in 2 ml of RTL buffer + 2mM DTT (Qiagen). mRNA was extracted from 300 ul of homogenate using the RNeasy Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... The clarified lysate was bound to a 2 mL slurry of Strep-Tactin Superflow plus (Qiagen) overnight at 4°C using the batch method ...
-
bioRxiv - Physiology 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen, Hilden, Germany, Cat. No. 19086) and then denatured using the Illumina protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were homogenized in a mixture of chloroform and methanol (2:1) using TissueLyser II (Qiagen) and dried in a Vacufuge (Eppendorf ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein extract was subjected to IMAC by incubation with 2 ml Ni-NTA resin (Qiagen, Germany) per 50 ml of extract ...
-
bioRxiv - Microbiology 2022Quote: ... pH 8.0) containing 15 mg/mL of lysozyme and 2 mg/mL of proteinase K (Qiagen), and incubated at RT for 10 min ...