Labshake search
Citations for Qiagen :
551 - 600 of 1727 citations for 5 Isobutyl thiophene 2 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Genomics 2023Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen, no. 30250) and kept on a rotator at room temperature for 1 h.
-
bioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 2 mL of RNAprotect bacterial reagent (Qiagen; 76506) and incubated at room temperature for 5 minutes prior to storage at - 80°C until further processing ...
-
bioRxiv - Microbiology 2023Quote: ... and the supernatant was loaded onto 2 ml Ni-NTA Superflow resin (Qiagen). The resin was washed once with 10 mL resuspension buffer and three times with 10 mL resuspension buffer supplemented with 30 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... consisting of 10 μl of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 7.2 μL nuclease-free water ...
-
bioRxiv - Cell Biology 2023Quote: ... Ishikawa and Caco-2 cell lines were transfected with 20 nM siRNA (Qiagen) using JetPRIME (Polyplus Transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... The tissue was fully homogenized in 2 ml of QIAzol buffer reagent (Qiagen) on ice and Dounce homogenization ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2-mercaptoethanol and then purified using the RNeasy mini kit (QIAGEN) for the QIAcube connect (QIAGEN ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR-2 products were pooled based on concentrations from capillary electrophoresis (QIAxcel, Qiagen). Final libraries were quantified by Qubit dsDNA High Sensitivity assay (ThermoFisher ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Developmental Biology 2023Quote: ... for Day 0 and 2 analyses or AllPrep DNA/RNA Mini Kit (Qiagen) for Day 4 and 6 analyses ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2024Quote: ... (NM-2) one negative control for the kit DNeasy Blood and Tissue (Qiagen) used for DNA extraction of minipig blood and (NM-3 ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... were first frozen in liquid nitrogen and then homogenized with a 5 mm ∅ metal bead (Qiagen) for 2 min at 40 Hz using TissueLyser LT (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... using stainless steel beads (5 mm mean diameter) and a TissueLyser LT adapter (Qiagen, Hilden, Germany) for 5 min at 50 Hz ...
-
bioRxiv - Immunology 2021Quote: ... the supernatant/Sepharose bead slurry was passed through a 5 ml polypropylene gravity flow column (Qiagen). The column was washed with 1 column volume of PBS before being eluted with 9 ml of Elution Buffer (0.1M Glycine/HCl buffer ...
-
bioRxiv - Genomics 2019Quote: ... All wells were then pooled and diluted 5:1 (∼24 mL) in Buffer PB (Qiagen #19066) with 1/20th volume of 3 M NaOAc pH 5.2 (∼1.2 mL) ...
-
bioRxiv - Pathology 2019Quote: ... The Pparα deletion was confirmed with PCR and HotStar Taq DNA Polymerase (5 U/μl, Qiagen) using the following primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... and resuspended in 10 mM Tris pH8 (500 μL) with 5 μL RNase A (Qiagen 19101) for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131 ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the tube together with a 5 mm stainless steel bead (Qiagen, Maryland, USA). The sample was homogenized for two minutes at 30 Hz using a TissueLyser II (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: ... Frozen tissues were placed into tubes containing a 5 mm stainless steel bead (Qiagen, Courtaboeuf, France) and 1 ml of Trizol reagent (Life Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... small RNA-enriched total RNA was treated twice with 5 μl of RNase-free DNase (Qiagen) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Biochemistry 2019Quote: ... The soluble fraction was loaded onto a column containing 5 ml Ni-NTA superflow resin (Qiagen), pre-equilibrated with buffer A ...
-
bioRxiv - Immunology 2020Quote: ... The bacterial lysates were mixed for 1 h with 5 ml of Ni-NTA resin (Qiagen) that had been equilibrated with buffer A ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Microbiology 2021Quote: ... sorokiniana were ground with two stainless steel beads (5 mm) using a TissueLyser (Qiagen, Hilden, Germany) at 30 Hz for 1 minute at room temperature and soaked in 1 ml of 100 mM sodium acetate buffer pH 5.0 at 70°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 50 mM Tris pH 8.0) using 5 mM stainless steel beads in a TissueLyser II (Qiagen). In vitro TPP1 assay was performed as described ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μL water and 5 μL 2x QuantiFast® SYBR® Green PCR Master Mix (Qiagen). Technical duplicates of this reaction mix were then analyzed on a Corbett Rotor-Gene 6000 real-time PCR cycler ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
Establishment of Wolbachia strain wAlbB in Malaysian populations of Aedes aegypti for dengue controlbioRxiv - Microbiology 2019Quote: ... Mosquitoes were homogenised in 175 µL of 5% Chelex® solution using TissueLyser II machine (Qiagen) and with 5 µL of proteinase K (20 mg/mL ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified lysate was applied to two tandemly-connected 5 ml Ni-NTA Superflow cartridges (Qiagen); the cartridges were washed with buffer containing 20 mM Tris pH 8.0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... sections were incubated in 0.08 M KOH for 5 min and washed by Buffer EB (Qiagen). Then ...
-
bioRxiv - Microbiology 2020Quote: ... The proteolysis reaction products were then passed over a 5 mL Ni-NTA superflow cartridge (Qiagen) to remove TEV and uncleaved protein ...
-
bioRxiv - Genomics 2020Quote: ... before aliquoting into 5 tubes and proceeding with the Qiagen DNeasy Plant Mini Kit (Qiagen; 69104) protocol ...
-
bioRxiv - Biophysics 2022Quote: ... to dephosphorylate 5’ ends.Digested inserts were gel extracted using the QiaQuick gel extraction kit (Qiagen, Germany). Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA from 5 embryos was extracted using the RNeasy microRNA isolation kit (Qiagen, Valencia, CA), and the RNA samples were digested on-column with RNase-free DNase I to eliminate genomic DNA ...
-
bioRxiv - Genomics 2022Quote: We extracted RNA from 5 × 105 cells using the QIAGEN RNeasy Mini kit (Qiagen, cat # 74014) with DNase I treatment (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Each reaction contained 5 μL DNA solution and PCR mixture with Taq Type-it (Qiagen®). PCR products were analyzed by capillarity electrophoresis on an ABl3130xl sequencer ...
-
p110α-dependent hepatocyte signaling is critical for liver gene expression and its rewiring in MASLDbioRxiv - Cell Biology 2024Quote: ... The p110α deletion was confirmed by PCR and HotStar Taq DNA Polymerase (5 U/μl, Qiagen) using two primer pairs ...
-
bioRxiv - Neuroscience 2023Quote: Isolated microglia were centrifuged for 5 min at 600xg and resuspended in RLT plus buffer (Qiagen) for extraction and purification of total RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of each reaction mixture was used for amplification with the REPLI-g kit (Qiagen) at 16 °C overnight and cleaned with the DNA Clean & Concentrator kit to yield samples for sequencing ...