Labshake search
Citations for Qiagen :
701 - 750 of 1199 citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 μg DNA ratio using Effectene transfection reagent (Qiagen). Recombinant luciferase-expressing viruses capable of a single round of replication were released into the cell medium and were harvested 48 h later ...
-
bioRxiv - Plant Biology 2022Quote: ... frozen in liquid nitrogen, ground to a fine powder (3 mm glass beads added to tissue, ground using tissue lyser (TissueLyser II, QIAGEN), 30/second frequency ...
-
bioRxiv - Biochemistry 2023Quote: ... K-R or K-Q mutant cells (post PNKP 3’-UTR siRNA transfection and GO/Bleo treatment) was performed using the QiaAmp DNA Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... Second strand synthesis was performed after thawing by the addition of 5 µL of second strand synthesis mix (3 µL of elution buffer [Qiagen] ...
-
bioRxiv - Cell Biology 2023Quote: ... All tissue samples were then centrifuged at top speed for 3 minutes and total RNA was purified from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Cells were lysed in 3% SDS in 10mM Tris pH = 7.5 by pipetting then centrifuge through a Qiashredder column (Qiagen #79656). Protein concentrations were determined by BCA assay (Thermo Fisher Scientific #23225) ...
-
bioRxiv - Microbiology 2023Quote: ... fresh 0.35 g/L proteinase K) during two rounds of 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). Total RNA was converted into complementary DNA (cDNA ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 µg DNA ratio using effectene transfection reagent (Qiagen). Recombinant ...
-
bioRxiv - Genomics 2023Quote: ... 1µM Template-Switching Oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” prefixes a ribonucleic acid base and “+” prefixes a locked nucleic acid base, Qiagen) then incubated using a ThermoMixer C with the following conditions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 20 ovaries were dissected from 3-day-old adult females and DNA extraction was performed using the Gentra Puregene Blood and Tissue kit (Qiagen). DNA samples used for PacBio sequencing were produced using the protocol described in (Ellegaard et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-5 mm ear primordia of the inbred line B73 using RNeasy Mini Kit (Qiagen) with on-column DNase I (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... mosquitoes were homogenized in 500 μl ice-cold 1X Phosphate Buffered Saline buffer with two ice-cold steel bearing balls (3 mm diameter, LOUDET) using a TissueLyser II (Qiagen) and clarified through centrifugation ...
-
bioRxiv - Bioengineering 2024Quote: Total RNA was isolated from untreated or RNP-transfected plerixafor-mobilized HD and SCD HSPCs (n=3 for each group) using the RNeasy Kit (QIAGEN) that includes a DNAse treatment step ...
-
bioRxiv - Neuroscience 2024Quote: Genomic DNA was isolated from ipsilateral and contralateral ventral midbrain hemispheres at 3 months after AAV-GFP or AAV-Cre-GFP injections using the DNeasy Blood and Tissue kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Cells were cultured on a glass substrate and soft hydrogel for 3 days and total RNA was extracted using RNeasy mini kit (Qiagen). RNA quantity and purity were verified using 2200 TapeStation system (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was harvested from 2-3 million HIV-dreGFP infected Jurkat cells exposed to EPZ-719 (500nM) or control (DMSO) using a RNEasy kit (Qiagen). RNA quantity and quality were then analyzed by nanodrop and Tapestation (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... and Chl523R (5’ CCY YMC GTA TTA CCG CAG CT 3’) targeting the 16S rRNA gene on a QIAcuity One digital PCR device (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... round 1 and 3 virus infections of GeCKO-A549 cells using the midi gDNA extraction kit (Qiagen, Germantown, MD, USA). The sgRNA’s DNA copies were PCR amplified from the extracted gDNAs for next generation sequencing (Fig 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the FT and Eluate fractions (90 µL each) were mixed with 10 µL 3 M sodium acetate and applied to a QIAquick spin column (Qiagen). Purified DNA was visualized a 1.3% agarose / 0.5x TBE gel and SYBR Green staining ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from cell lines in 3 biological replicates after each CRISPR/Cas9 oncogene downregulation using QIAzol (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Neuroscience 2023Quote: ... GFP+ and GFP- nuclei were sorted using a BD AriaFACS III (University of Washington Pathology Flow Cytometry Core) into a PCR tube strip containing 3 µL of REPLI-g Advanced Single Cell Storage buffer (Qiagen). Whole genome amplification (WGA ...
-
bioRxiv - Microbiology 2023Quote: ... tissues were placed in 300μL of sterile PBS containing sterile glass beads and mechanically lysed at a frequency of 20 shakes per seconds for 3 minutes in a TissueLyser II (Qiagen). Negative controls consisted of tubes containing PBS and beads but no sample ...
-
bioRxiv - Microbiology 2023Quote: DNA extraction was carried out with 37 mg of freeze-dried mycelium using the Nucleospin Microbial DNA kit in combination with 3 mm tungsten carbide beads (Qiagen) for tissue disruption in a MM 301 vibratory mill ...
-
bioRxiv - Cancer Biology 2022Quote: 3 Type D and 3 Type V SCLC tumor-derived cell lines were treated with either vehicle (EtOH) or 4-OHT for 3 days and RNA was isolated using the RNeasy Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Tissue cultures that were cultivated on one filter membrane (3 cultures) were transferred as one sample into RLT buffer (QIAGEN) and RNA was isolated according to the manufacturer’s instructions (RNeasy Plus Micro Kit ...
-
bioRxiv - Developmental Biology 2022Quote: A repair template containing TagRFP-T::AID with homology at the 5’ and 3’ ends to the egl-43 locus was PCR amplified and purified using a PCR purification kit (Qiagen). 3 μl of 10 μM tracRNA (IDT ...
-
bioRxiv - Cell Biology 2022Quote: RNA was extracted from cryo-pulverized inguinal adipose tissue from freely-fed 14-day-old mice (n=3 male and female for PTPN23H/H and PTPN23+/+) using the RNeasy Mini Kit (74104; Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... were annealed (10 μL each 100 μM) to 10 μL 5′-[Phos]-CTGTCTCTTATACACATCT-3’ oligonucleotide (100 μM) within 80 μL EB buffer (Qiagen), incubating 2 min at 95°C and cooled to room temperature (0.1°C/sec) ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA was isolated 3 or 8 days after editing by a QIAamp DNA Mini Kit or Micro Kit (QIAGEN). The genomic region flanking the CRISPR/Cas9 cleavage site was PCR-amplified ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were washed 3 times with PBS to eliminate unbound FVVs and RNAs were extracted using RNeasy plus mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... The process was repeated twice (3 in total) and the leukocyte enriched pellet was lysed in 350 µl RLT buffer (Qiagen) and stored at −20 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... The tissue was then ground to a fine powder using 3/16 inch (4.76mm) ball bearings in a Tissuelyzer II (Qiagen, Germany) in the presence of dry ice in the pockets around tube holders ...
-
bioRxiv - Plant Biology 2023Quote: ... the resulting dried leaves were then ground to powder with a 3-mm glass bead placed in a tube with a Tissuelyser mill (Qiagen). The ground samples were incubated at 4°C in DNA extraction buffer (200 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2023Quote: Two-week-old Arabidopsis seedlings of Col-0 wild type and trb1/2/3 triple mutans were used for DNA extraction using DNeasy Plant Mini Kit (QIAGEN). A total of 500 ng DNA was sheared with Covaris S2 (Covaris ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was isolated from 2000 cells per replicate and 3 replicates per treatment by the micro RNeasy kit (QIAGEN) for both mouse muscle satellite cells and ZeMPCs ...
-
bioRxiv - Genetics 2022Quote: RNA from cortex and hippocampus derived ex vivo cultures was extracted from 3 biological replicates for three time points (DIV3, DIV15, DIV31) using RNeasy Plus Mini Kit (Qiagen). cDNA was synthesized using a SuperScript IV Reverse Transcriptase cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... centrifuged to 300 xG for 3 mins and dissociated using RLT buffer as recommended by RNeasy Plus Mini Kit (74134, Qiagen). All RNA isolation steps were done as recommended by the RNeasy kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting 1683 bp product spanning the 3’ end of MYO2 upstream of the integration site through the 3’ untranslated region was then isolated using a PCR purification kit (Qiagen), and mutations were confirmed by sequencing using primer 5’- CTCATTTGTGGTGTTTGCTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... BioConcept) in TAE buffer (3-07F03-I, BioConcept) and products were extracted using the QIAquick Gel Extraction Kit (28706, Qiagen) and Sanger sequenced by Microsynth (Balgach ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial cells were harvested from the surface of the cheese agar by using a sterile razor blade and were then immediately placed into 3 mL of RNAProtect Bacteria Reagent (Qiagen) and frozen at -80C until RNA extraction ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2024Quote: ... was added to each tube and homogenized at 30 rev/s for 3 minutes for 2 rounds using a tissue homogenizer/lyser (#9003240, Qiagen). Kidney extracts were centrifuged at 17,000 RCF for 10 minutes and the supernatant was transferred to a 1.5 mL microcentrifuge tube and kept over ice for 1-2h ...
-
bioRxiv - Pathology 2024Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Genetics 2024Quote: RNA was isolated from 10 wandering third-instar larvae (3 biological replicates per genotype; WT, pr-set720 and parp-1C03256) using RNeasy lipid tissue mini kit (Qiagen). RNA samples were flash-frozen in liquid nitrogen and sent to Novogene for library preparation and sequencing ...
-
bioRxiv - Genomics 2024Quote: DNA was extracted from approximately 3 ml of whole blood using the Gentra Puregene Blood Kits (#158467; Qiagen, Hilden, Germany), following the “Whole Blood” subsection in the manufacturer-provided handbook ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final samples of 3 or 30 million cells were collected and genomic DNA was extracted (DNeasy blood and Tissue kit, Qiagen). Next ...