Labshake search
Citations for Qiagen :
701 - 750 of 1319 citations for Recombinant Human S100 Calcium Binding Protein A9 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from human or murine cells using the RNeasy Mini Kit (Qiagen), and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from sorted infected primary human hepatocytes using miRNeasy Micro Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from human primary cells using AllPrep RNA/RNA/miRNA universal kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from sampled human brains using miRNeasy Mini Kit (Qiagen, CA, USA). The tissue samples were homogenized in QIAzol (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... and human islets was isolated using RNeasy Mini or Micro kits (Qiagen, Valencia, CA, USA). Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Lysates were incubated for 1 hr at 37°C after adding 10 µl of RNAse A (20 mg/ml) and proteins were precipitated with 200 µl of Protein Precipitation Solution (Qiagen Gentra Puregen Cell kit). After centrifugation ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein was purified using Ni-NTA Fast Start (Qiagen, #30600) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2021Quote: ... refolded protein mixture was loaded on Ni-NTA beads (Qiagen) as 1ml per 2 liter culture ...
-
bioRxiv - Neuroscience 2019Quote: ... for protein extraction or 200 µL of RLT buffer (Qiagen) for RNA extraction and stored at −80°C until further sample processing.
-
bioRxiv - Biochemistry 2019Quote: ... Proteins were purified by Ni2+-affinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein was affinity-purified using Ni-NTA agarose (Qiagen #301210), and exchanged into severing buffer I (SBI ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein crystallization was screened for in commercially available screens (Qiagen), using a Crystal Gryphon robot (Art Robbins Instruments) ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was purified using Ni-NTA affinity columns (Qiagen) and subsequently purified by gel filtration using a HiLoad Superdex 75 pg column (GE) ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were then purified using Ni-NTA agarose (Qiagen 30210). The amount of purified protein was estimated both by conducting BCA assays (Thermo Fisher 23225 ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: ... RNA was extracted using the Allprep RNA/Protein Kit (Qiagen). The quality and quantity of RNA were assessed using the Experion RNA Analysis Kit (BioRad ...
-
bioRxiv - Immunology 2019Quote: ... Proteins were purified by affinity chromatography on NiNTA agarose (Qiagen), followed by FPLC on MonoQ (GE Healthcare ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was isolated by Ni-NTA affinity chromatography (Qiagen) and eluted with 50 mM Tris buffer pH 7.5 ...
-
bioRxiv - Synthetic Biology 2020Quote: Protein purification was done using Ni-NTA Spin Columns (Qiagen) following the supplier recommendations ...
-
bioRxiv - Cancer Biology 2020Quote: ... or the AllPrep DNA/RNA/Protein mini kit (Qiagen #80004) and quantified using 2100 Bioanalyzer (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: ... The proteins were purified using Ni-NTA agarose resin (Qiagen), washed with 20 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... proteins were affinity purified on Ni-NTA agarose beads (Qiagen). Proteins eluted from Ni-NTA beads by stepwise addition of increasing concentrations of 50-300 mM imidazole in a buffer containing 20 mM HEPES pH 7.4 ...
-
bioRxiv - Immunology 2021Quote: ... and the resulting proteins were purified using Ni-resins (Qiagen) and size exclusion chromatography (HiLoad Superdex 75 ...
-
bioRxiv - Immunology 2021Quote: ... and the resulting proteins were purified using Ni-resins (Qiagen). The vector encoding a hexa-His tag fused to a single chain homotrimeric mLIGHT extracellular domain (G73-V239 ...
-
bioRxiv - Bioengineering 2022Quote: ... Pan-Fzd protein was purified using Ni-NTA Agarose (Qiagen), followed by biotinylation and size-exclusion chromatography with a Superdex S75 column (GE Healthcare) ...
-
bioRxiv - Neuroscience 2022Quote: Protein phosphorylation assay was performed using PhosphoProtein Purification Kit (Qiagen), exactly as described by manufacture’s guideline ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with Ni-NTA Agarose Resin (Qiagen), followed by cation exchange chromatography using Source 15S Resin (Cytiva) ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with Ni-NTA Agarose Resin (Qiagen), followed by cation exchange chromatography using Source 15S Resin (Cytiva) ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with Ni-NTA Agarose Resin (Qiagen), followed by affinity-purification with amylose resin (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... The PELO protein was purified with Ni2+-NTA-agarose (Qiagen) and followed by further purification by Superdex 200 10/30 prepacked column (GE Healthcare) ...
-
bioRxiv - Microbiology 2024Quote: ... The protein was isolated using a Ni-NTA column (Qiagen). 25 μg of isolated protein was used to immunize mice by subcutaneous injection with complete Freund’s adjuvant and boosted three times with incomplete Freund’s adjuvant to generate PfATP4 antibody.
-
bioRxiv - Cell Biology 2022Quote: ... KASH5 fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein alignment was performed with CLC Genomics Workbench 22.0.1 (Qiagen) using MUSCLE v3.8.425 (Edgar ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were purified by Ni2+-affinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...