Labshake search
Citations for Qiagen :
651 - 700 of 1263 citations for Recombinant Human S100 Calcium Binding Protein A9 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... Proteins were either purified using NI-NTA agarose (Qiagen) or anti C-tag beads ...
-
bioRxiv - Plant Biology 2021Quote: ... labeled proteins were incubated with Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... the protein was purified by Ni-NTA agarose (Qiagen) and eluted with lysis buffer containing 300 mM imidazole ...
-
bioRxiv - Microbiology 2020Quote: Protein was purified using Ni-NTA agarose column (Qiagen). A detailed protocol is described in supplementary materials and methods.
-
bioRxiv - Genetics 2021Quote: ... The AllPrep DNA/RNA/Protein Mini Kit (Qiagen 80004) was used to extract total RNA in DEPC-treated water ...
-
bioRxiv - Neuroscience 2020Quote: ... GAPDH protein was purified by Ni-NTA chromatography (Qiagen) under native conditions ...
-
bioRxiv - Biophysics 2021Quote: ... Proteins were purified using Ni-NTA resin (Qiagen, Germany) on a gravity flow column followed by size-exclusion chromatography on a Superdex® 200 Increase 10/300 GL column (GE Healthcare Life Sciences ...
-
bioRxiv - Biophysics 2020Quote: ... Protein purification was performed using Ni-NTA resin (Qiagen) equilibrated with the lysis buffer containing 20 mM imidazole ...
-
bioRxiv - Biophysics 2022Quote: ... Proteins were purified by Nibaffinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...
-
bioRxiv - Genomics 2019Quote: ... We added 200 µl of Protein Precipitation Solution (Qiagen) and centrifuged at 15,000 rpm for 3 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Genes for protein purification were cloned into pQE30 (QIAGEN). Raw 264.7 and U937 cells were cultured in RPIM1640 medium in the presence of 10% FBS ...
-
bioRxiv - Genomics 2020Quote: ... total proteins and RNA were extracted (RNeasy Qiagen 74104) according to the manufacturer’s instructions and analyzed.
-
bioRxiv - Microbiology 2023Quote: ... The proteins were purified with Ni-column chromatography (Qiagen) by following the manufacturer’s recommendations.
-
bioRxiv - Biochemistry 2023Quote: ... Fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was purified through Ni-NTA agarose beads (Qiagen) (Lysis Buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Expressed proteins were captured on Ni-NTA Superflow (Qiagen) equilibrated with Buffer A containing 5 mM imidazole ...
-
bioRxiv - Biochemistry 2023Quote: ... protein was captured using Ni-NTA affinity chromatography (Qiagen). Protein was further purified using ion exchange chromatography preceding size exclusion chromatography on a HiLoad 16/600 Superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein was purified with Ni-NTA Agarose (Qiagen), dialyzed to PBS containing 6 M urea ...
-
bioRxiv - Biochemistry 2024Quote: ... protein purification was performed using Co+NTA agarose (Qiagen), followed by a Phenyl Sepharose column ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from human or murine cells using the RNeasy Mini Kit (Qiagen), and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from sorted infected primary human hepatocytes using miRNeasy Micro Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from human primary cells using AllPrep RNA/RNA/miRNA universal kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from sampled human brains using miRNeasy Mini Kit (Qiagen, CA, USA). The tissue samples were homogenized in QIAzol (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... and human islets was isolated using RNeasy Mini or Micro kits (Qiagen, Valencia, CA, USA). Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2019Quote: ... Lysates were incubated for 1 hr at 37°C after adding 10 µl of RNAse A (20 mg/ml) and proteins were precipitated with 200 µl of Protein Precipitation Solution (Qiagen Gentra Puregen Cell kit). After centrifugation ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein was purified using Ni-NTA Fast Start (Qiagen, #30600) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2021Quote: ... refolded protein mixture was loaded on Ni-NTA beads (Qiagen) as 1ml per 2 liter culture ...
-
bioRxiv - Neuroscience 2019Quote: ... for protein extraction or 200 µL of RLT buffer (Qiagen) for RNA extraction and stored at −80°C until further sample processing.
-
bioRxiv - Biochemistry 2019Quote: ... Proteins were purified by Ni2+-affinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein was affinity-purified using Ni-NTA agarose (Qiagen #301210), and exchanged into severing buffer I (SBI ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein crystallization was screened for in commercially available screens (Qiagen), using a Crystal Gryphon robot (Art Robbins Instruments) ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was purified using Ni-NTA affinity columns (Qiagen) and subsequently purified by gel filtration using a HiLoad Superdex 75 pg column (GE) ...