Labshake search
Citations for Qiagen :
701 - 750 of 1363 citations for Mouse Anti Hepatitis C Virus NS5a Antibody 1827 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... 48 hours post infection urine was collected from each mouse directly into bacterial RNAprotect (Qiagen). All collected urine was pooled together and pelleted ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted from distinct mouse brain regions using the RNeasy Mini Kit (QIAGEN). The QuantiTect Reverse Transcription Kit (QIAGEN ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Microbiology 2019Quote: ... mouse faecal samples were extracted with the QIAamp DNA FAST Stool Mini Kit (QIAGEN, Germany) (Lim et al. ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from mouse skin-punch biopsies using the DNeasy tissue kit (QIAGEN, #69506) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... paraffin-embedded (FFPE) stomach sections per mouse using the AllPrep DNA/RNA FFPE Kit (Qiagen) and gene expression was detected using the nCounter Mouse Immunology Panel (NanoString) ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was isolated from mouse retinas or from HRMEC culture with RNeasy Kit (Qiagen) based on manufacturer protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... Each biological replicate (mouse) was run in triplicate and 18S ribosomal RNA (Rn18S, Qiagen, QT02448075) was used as a house keeping gene for normalization.
-
bioRxiv - Cell Biology 2021Quote: ... adipocytes and mouse adipose tissue RNeasy Lipid Tissue Mini Kit was used (Qiagen, cat. 74804) following manufacturer instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... the mouse spinal cord sections were treated with 10 μg/mL proteinase K (QIAGEN, 19131) at 37°C for 5 min and then post-fixed in 4% PFA at RT for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA was isolated from frozen mouse whole brains using the RNeasy Midi kit (Qiagen). QRT-PCR was performed according to a two-step process using the Quantitect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from mouse hearts was extracted using QIAGEN’s miRNeasy Mini kit (217004; Qiagen, Germany). The reverse transcription step was performed using Takara’s PrimeScriptTM RT Master Mix (RR036A ...
-
bioRxiv - Molecular Biology 2022Quote: RNAs from HUVECs or mouse lung ECs (mLECs) were purified using RNeasy-kit (74106, Qiagen). The RNA was reverse transcribed High-Capacity cDNA Reverse Transcription Kit (4368813 ...
-
bioRxiv - Pathology 2023Quote: Mouse tissues were homogenized with a 5 mm steel bead using a TissueLyser II (QIAGEN) for 5 min at frequency of 30 times/second ...
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA from mouse blood was extracted using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from astrocytes of mouse brain using a RNeasy mini kit (Qiagen). For each sample ...
-
bioRxiv - Physiology 2024Quote: Total islet RNA (200–300 islets/mouse) was extracted using the RNeasy Mini Kit (Qiagen). RNA concentration and integrity were assessed using the ND-1000 Spectrophotometer (NanoDrop) ...
-
bioRxiv - Neuroscience 2023Quote: RNA from bulk mouse brain tissue was extracted using the RNeasy Plus Mini Kit (Qiagen) and resuspended in nuclease-free water ...
-
bioRxiv - Microbiology 2019Quote: ... A 10 nM solution of biotinylated penta-His antibody (Qiagen) was incubated for 10 min on the neutravidin-coated surface and excess unbound antibody removed (22 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were harvested by centrifugation at 4°C followed by cell lysis/RNA extraction using RNEasy plus mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysate [1μg/μL] was RNase A digested at 37°C for 15 min following addition of 1 μg RNase A (Qiagen) per 25 μg protein ...
-
bioRxiv - Cancer Biology 2021Quote: ... Inoculants from glycerol stocks or stab culture were cultured overnight in liquid LB at 37°C and plasmids were extracted using Plasmid miniprep kit (Qiagen). See Key Resources Table for shRNA identity ...
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was further digested with TURBO DNase overnight at 37°C (10 U per 2 μg of RNA) and purified with the RNeasy MinElute Cleanup Kit (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Developmental Biology 2021Quote: ... The samples were incubated at 37 °C for 16 hours overnight and were in turn cleaned-up using the QIAquick PCR Purification kit (QIAGEN) and eluted with 40 μl of 50 °C water ...
-
bioRxiv - Genetics 2020Quote: ... Ligation was carried out overnight at 16°C followed by overnight cross-link removal with 20mg/ml Proteinase K (Qiagen). The samples were purified using phenol-chloroform and ethanol precipitated resulting in 3C libraries ...
-
bioRxiv - Microbiology 2019Quote: ... snap frozen on dry ice and stored at −80°C until RNA purification with the Qiagen AllPrep RNA/DNA kit (Qiagen). Immunoglobulin amplicon preparation ...
-
bioRxiv - Genomics 2020Quote: ... 25ng of the purified product was subjected to self-ligation at 16 °C overnight in a total volume of 50uls and column purified using Qiagen (Qiagen) PCR purification kit as per manufacturers recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Five colonies with the correct sized insert were inoculated into liquid LB supplemented with spectinomycin and chloramphenicol and grown overnight at 37°C for plasmid extraction using a QIAprep Spin Miniprep Kit (Qiagen). The plasmid constructs were confirmed by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets were resuspended in lysis buffer and stored at -80°C before DNA or total RNA extraction with the Genomic DNA Mini (Blood/Culture Cell) (Genesis) or mRNAeasy (Qiagen) kits ...
-
bioRxiv - Biophysics 2022Quote: ... Purified protein was diluted in PBS buffer (pH = 7.2) and the fluorescence intensity was recorded at 60 °C in the Rotor-Gene 6600 real-time PCR cycler (Qiagen) for 18 h ...
-
bioRxiv - Genomics 2019Quote: ... with the addition of 20 μl of proteinase K (20 mg/ml) followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.) ...
-
bioRxiv - Genomics 2020Quote: ... We stored tissue at 4 °C for 24-72 hours prior to extracting DNA with a DNAeasy Blood and Tissue Kit (Qiagen) with on-column RNase A treatment following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: Tissue samples were snap frozen in liquid Nitrogen and stored at −80 °C until genomic DNA (gDNA) was extracted using DNeasy blood and tissue kit (QIAGEN). Tissues were lysed in 360 µL of lysis solution on a Precellys 24 homogenizer for 30s at 4.0 ms−1 ...
-
bioRxiv - Microbiology 2019Quote: ... medium at 37°C and was made competent with rubidium chloride according to the method provided in the QIAexpressionist manual protocol 2 (Qiagen). When antibiotic selection was required ...
-
bioRxiv - Genomics 2019Quote: ... transposition was performed on 25,000 sorted tetraploid nuclei at 37°C for 30 minutes followed by DNA purification with the MinElute Reaction Cleanup Kit (28206, QIAGEN). DNA fragments were PCR preamplified for 5 cycles initially ...
-
bioRxiv - Neuroscience 2019Quote: ... EST plasmids were grown in Luria Bertani (LB) media overnight at 37°C and purified before further use (QIAprep Spin Miniprep Kit, Qiagen). Plasmids were linearized with PauI (New England Biolabs ...
-
bioRxiv - Genetics 2019Quote: ... After 16 hrs in a 37°C shaker bacteria were harvested and plasmid DNA was isolated using a Megaprep kit (Qiagen). ITR integrity was confirmed by digestion with XmaI as well as with AhdI ...
-
bioRxiv - Developmental Biology 2019Quote: ... Cross-linking was reversed by incubation overnight at 65 °C and DNA was purified using a MinElute PCR purification kit (Qiagen). All IP DNA and 1 ng of input DNA were used for library preparation using the ThruPLEX-FD Prep Kit or ThruPLEX DNA-Seq (Rubicon Genomics) ...
-
bioRxiv - Developmental Biology 2020Quote: ... In vitro transcribed mRNAs were DNAse-treated using TURBO-DNAse for 15 min at 37°C and purified using the RNeasy Mini Kit (Qiagen) and quantifed using Qubit™ RNA BR Assay Kit (ThermoFisher ...
-
bioRxiv - Genetics 2019Quote: ... Crosslinking was then reversed by overnight incubation at 65°C and DNA purified using QIAquick PCR purification column (Qiagen, 28104). Immunoprecipitated DNA was then quantified via Qubit (ThermoFisher ...
-
bioRxiv - Systems Biology 2020Quote: ... cultures were harvested in RLT buffer and stored at −80°C before isolation of RNA using the RNeasy Mini Kit (Qiagen). mRNA was isolated from 1 ug total RNA by poly-dT enrichment using the NEBNext Polya ...
-
bioRxiv - Genetics 2019Quote: ... Cross-links were reversed at 65°C overnight (16 hrs) and DNA was purified using a PCR purification kit (Qiagen). DNA content was quantified by RT-PCR using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... 72 °C - 10 min) and amplicons separated using a Qiaxcel Advanced Separation System using 15 - 3000 bp markers (Qiagen, UK).
-
bioRxiv - Genomics 2019Quote: ... The transposition reaction was performed at 37°C for 30 min and was followed by purification of the samples using the Qiagen MinElute PCR purification kit (Qiagen). Transposed DNA fragments were amplified for 11 cycles using the NEBnext high-fidelity PCR master mix and the Ad1_noMX and Ad2.1-2.6 barcoded primers from (10) ...
-
bioRxiv - Biochemistry 2021Quote: ... The insoluble fraction was precipitated by ultracentrifugation (20,000 g) for 30 minutes at 4°C and the supernatant was loaded onto a Ni-NTA superflow affinity column (QIAGEN). The Ni-column was then wash three times and eluted with buffer containing 30 mM HEPES (pH 7.8) ...
-
bioRxiv - Immunology 2021Quote: ... Samples were then centrifuged and plasma isolated and stored at -20°C prior to testing in the QuantiFERON IFNγ ELISA (Qiagen). Acceptance criteria for the assay specified by manufacturers were always met.
-
bioRxiv - Neuroscience 2020Quote: ... at 60°C overnight and 1 μl of a 1:20 dilution of the lysate used in a PCR reaction (HotStarTaq, Qiagen). The sequence flanking the tmt-opsin1b TALEN binding sites was amplified using the forward 5’-GGGACTTTCTTTGCGCTTTA-3’ and the reverse 5’-CAGGTCAGAGCGGATCTCAT-3’ primers ...