Labshake search
Citations for Qiagen :
651 - 700 of 1718 citations for Dengue Virus serotype 2 lysate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Cell debris was removed by centrifugation and clarified soluble lysate was incubated with Ni-NTA resin (Qiagen) pre-equilibrated with Ni-NTA binding buffer ...
-
bioRxiv - Zoology 2019Quote: ... The lysate was then mixed with 450 µl 1 × TE buffer and 3750 µl PB buffer (Qiagen) and the entire volume of the mixture was centrifuged through a MinElute (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... Lysate was applied to a column packed with 600 μL 50% slurry Ni-NTA agarose beads (Qiagen), washed twice with buffer A + 0.05% Tween-20 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The lysate was checked for homogeneity and transferred to a QIAshredder (QIAGEN Germantown, MD, USA; Cat#79656). DNA/RNA was then isolated per the kit’s instruction ...
-
bioRxiv - Immunology 2020Quote: ... Lysate was then chloroform extracted for RNA and purified via a Qiagen RNA Easy isolation kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... The soluble fraction was purified from the cell lysate using Ni2+-nitrilotriacetate affinity resin (Ni-NTA, Qiagen). The protein was then further purified by further purified by gel filtration (Superose 6 ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was also isolated from the infected cellular lysates using RNeasy mini kit (Qiagen, Hilden, Germany) for analysis of intracellular SARS-CoV-2 RNA ...
-
bioRxiv - Microbiology 2021Quote: ... Purification was performed by incubating the cleared lysate with 1 mL Ni-NTA resin (Qiagen, Hilden, Germany) on a rotating platform at 4°C for 2 h ...
-
bioRxiv - Biochemistry 2021Quote: ... The polyhistidine-tagged recombinant proteins were then purified from bacterial lysates with Ni2+-NTA agarose beads (QIAGEN) and washed by three different washing buffers (Washing buffer 1 contained 20 mM Tris-HCl ...
-
bioRxiv - Microbiology 2021Quote: ... 300mM NaCl and 5% glycerol and the clarified lysate was loaded on a Ni-NTA column (Qiagen). Non-specifically bound proteins were removed by washing with lysis buffer containing 40mM imidazole and σA eluted with 150mM imidazole ...
-
bioRxiv - Genomics 2020Quote: ... The lysate was processed using reagents and columns from an AllPrep DNA/RNA Mini Kit (Qiagen, 80204). Concentration of the final eluate was assessed employing standard methods ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from MDA-MB-231 and Hs578T cell lysates using RNAeasy purification kit (Qiagen). The quality of RNA was assessed on the Agilent 2100 Bioanalyzer and the RNA was quantified by QuBit fluorometry ...
-
bioRxiv - Biochemistry 2022Quote: ... the lysate was supplemented with Ni-NTA agarose (Qiagen, 1.3 ml resin/ 1 l insect cell pellet). Subsequently ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was applied to 4 ml bed volume Ni-NTA Agarose beads (Qiagen, cat. No. 30210) for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... 20 µL of tissue lysates were taken for DNA isolation using DNeasy Blood & Tissue Kit (Qiagen, 69506) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were lysed by sonification and clear lysates were incubated with Ni-NTA agarose beads (Qiagen, 30210) in binding buffer (50mM Tris-HCL ...
-
bioRxiv - Cell Biology 2023Quote: ... The cleared lysate was then mixed with nickel-nitrilotriacetic acid (Ni-NTA)-agarose beads (QIAGEN, Hilden, Germany) or glutathione (GSH ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from cell lysates and brain homogenates using the RNeasy Lipid Tissue kit (Qiagen, #74804) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA extraction was done on mouse kidney lysate using the RNeasy Plus Universal Midi kit (Qiagen). RNase digestion was then performed on the RNA extract using the following RNases ...
-
bioRxiv - Bioengineering 2023Quote: Total mRNA was isolated from the cell lysates using a RNeasy Micro Kit (Cat. No. 74004; Qiagen). The amount and quality of total RNA were assessed using a Thermo Fisher NanoDrop spectrophotometer ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acid was extracted from 200 μl of each sample using the QIAamp MiniElute™ Virus Spin Kit nucleic acid (for DNA and RNA) according to the manufacturer (QIAgen Canada, Toronto, ON, Canada). DNA samples were stored at −80°C and assayed in duplicate by qPCR ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysate was cleared by centrifugation at 25,000g for 30 min and incubated with Ni-NTA agarose (Qiagen, 30210) at 4°C for 1 h (0.5 ml resin per 50 ml supernatant) ...
-
bioRxiv - Cancer Biology 2019Quote: Cell lysates were harvested following an 8 hour E2 or DMSO control induction with buffer RLT plus (Qiagen) containing 1% beta-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Genetics 2020Quote: ... lysed and DNA and RNA were extracted from the lysate using the AllPrep DNA/RNA Micro kit (Qiagen) and quantified (Nanodrop 1000 spectrophotometer ...
-
bioRxiv - Biochemistry 2019Quote: ... Proteins were purified from the cell lysate by affinity chromatography using a Nickel-NTA column (Qiagen, Valencia, CA). A solution containing 20mM HEPES pH7.2 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from 300µL homogenized tumor lysates using the AllPrep DNA/RNA Mini Kit (QIAGEN, Cat. # 80204) and eluted into 100µL EB Buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA from total spinal cord and brain lysates as well as corpus callosum was isolated using QIAzol (Qiagen) and the RNeasy protocols (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was extracted from the lysate using a Qiagen DNeasy 96 well Blood & Tissue Kit (Qiagen, Hilden, Germany). Finally ...
-
bioRxiv - Microbiology 2021Quote: ... the cell lysate was loaded by gravity flow onto a column containing 1 ml Ni-NTA resin (Qiagen) equilibrated with buffer A ...
-
bioRxiv - Cell Biology 2022Quote: ... The clarified lysate was supplemented with Ni-NTA agarose (1.3 ml resin/ 1 l insect cell pellet, Qiagen) and incubated for 30 mins at 4 °C on a rotating wheel ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lysates were clarified by centrifugation and proteins in the supernatant were purified using Ni-NTA chromatography (Qiagen) for His-tagged proteins or Glutathione Sepharose 4 Fast Flow beads (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA of Mtb positive cultures was purified from cleared lysate using a QIAamp DNA mini Kit (Qiagen). DNA libraries were prepared with Nextera XT kit (Illumina ...
-
bioRxiv - Physiology 2021Quote: Total RNA was isolated from PHT lysates and genomic DNA removed using the RNeasy Plus Mini Kit (Qiagen). RNA quality was assessed using the RNA Nano kit on an Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... FasRΔ33 or FasR point mutants were separated from whole-cell lysates by Ni-NTA agarose chromatography (Qiagen, Inc). After three washing steps with lysis buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 1mM PMSF and 0.25% sodium deoxycholate and the clarified lysate was loaded on a Ni-NTA column (Qiagen). Non-specifically bound proteins were removed by washing with lysis buffer containing 20mM imidazole and the proteins eluted with buffer containing 150mM imidazole ...
-
bioRxiv - Immunology 2020Quote: ... Monocytes were lysed and each cell lysate was homogenized by passing through Qia-shredder columns (Qiagen, Hilden, Germany). Each monocytes lysate was then mixed 1:1 with 70% ethanol (equal volume ...
-
bioRxiv - Cell Biology 2022Quote: ... and the soluble fraction of the lysate was incubated with Ni2+-nitrilotriacetic acid (NTA) beads (Qiagen, Hilden, Germany). Proteins were eluted with 300 mM imidazole in 60 mM NaH2PO4 ...
-
bioRxiv - Microbiology 2022Quote: High-titer lysates of all phages were prepared by confluent lysis (42) and purified (Lambda Midi Kit, Qiagen). DNA content of samples was quantified (Quant-iT DNA assay kit ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged talin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged vinculin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a Q-Sepharose ion exchange column ...
-
bioRxiv - Biophysics 2023Quote: ... lysates were brought to 250 mM NaCl and applied to a benchtop column containing Ni-NTA resin (Qiagen) equilibrated in Equilibration Buffer (25 mM Tris pH 8.0 ...
-
bioRxiv - Immunology 2023Quote: ... sdAb and proteins from bacterial cell lysates (SLP and TXA1) were purified with Ni-NTA resin (Qiagen: 30210), using Tris Buffered Saline (TBS ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting lysate was used for RNA extraction using the RNA-easy Plus Mini Kit (Qiagen; cat.no., 74134) as per the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... After centrifugation (30 min, 100,000 x g, the cleared lysate was purified via Ni-NTA agarose columns (Qiagen) and eluted with a discontinuous imidazole gradient using an ÄktaGo system ...
-
bioRxiv - Cancer Biology 2021Quote: ... tissue lysates were prepared according to the kit instructions and tissue clumps were removed using QIAshredder columns (Qiagen, 79654). Cleared lysates were applied to RNeasy silica columns and on-column DNase digestion was performed using RNase-Free DNase Set (QIAGEN ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cell lysate was centrifuged at 105,000xg for 1h30 and the supernatant was applied to Ni-NTA Superflow resin (QIAGEN) equilibrated in buffer EQ/W ...