Labshake search
Citations for Qiagen :
651 - 700 of 3161 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... 5 μl of proteinase K (approximately 3 U, Qiagen, cat. # 19131) were added and incubated for 1 h at 56°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen, #1027281). After 72 h ...
-
bioRxiv - Cell Biology 2023Quote: ... using 30 nM Hs_LUZP1 siRNA (target sequence, 5′-CAGCGGGTGCTGAGAATTGAA-3′; QIAGEN) or 30 nM AllStars negative-control siRNA (QIAGEN) ...
-
bioRxiv - Cell Biology 2024Quote: ... HOXD11 (Qiagen, Sequence: 5′-TGC TAG CGA AGT CAG A-3′), HOXD13 (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... HOXD13 (Qiagen, Sequence: 5′-CAT CAG GAG ACA GTA T-3′), for 24hr and 48hr for RNA and protein extraction respectively ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Systems Biology 2024Quote: ... NTA-agarose resin (1 mL) (Qiagen) was washed twice with 3 ml of distilled water and 2 ml of 100 mM FeCl3 in 0.1% acetic acid was added ...
-
bioRxiv - Developmental Biology 2024Quote: ... SFPQ siRNA #1 (Qiagen Cat#SI05783848), and SFPQ siRNA #2 (Qiagen Cat#SI05783876 ...
-
bioRxiv - Plant Biology 2024Quote: ... mixed with 1% beta-mercaptoethanol (Qiagen) using Kimble Chase glass tissue grinders (part# KT885450-0020) ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.5-1 μg of total RNA was reverse transcribed into first-strand cDNA using an RT2 First Strand Kit (QIAGEN). The resultant cDNA was subjected to qPCR using human cytokine-specific primer (Realtimeprimers.com ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA was separated on a 1% agarose gel and the ∼5 Kb genomic DNA band was harvested with a QIAquick Gel Extraction Kit (Qiagen). The DNA library was prepared according to the manual of the Ligation Sequencing Kit (Nanopore) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed by boiling (5 min 95°C) followed by bead beating (3mm beads, 30 Hz for 1 min) (TissueLyser II, Qiagen) and sonication bath (3×10 sec at 4°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... several loci were amplified simultaneously from 1 μl of extracted DNA using 5 μl of the Multiplex PCR Master Mix (Qiagen) and varying amounts of the pooled primer mixes (Pool A ...
-
bioRxiv - Microbiology 2021Quote: ... samples were weighed and homogenized in DMEM containing 10% FBS and 1% antibiotics using 5 mm stainless steel beads (Qiagen) and the TissueLyser II (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... The bead-bound gDNA was isothermally amplified for 3 hours at 30 °C then 10 minutes at 65 °C using a miniaturised (1/5 vols) Repli-g Single-Cell assay (Qiagen). The amplified gDNA was cleaned up with 0.8 × vols Ampure XP and 80 % ethanol ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Microbiology 2023Quote: ... Metagenomic sequencing libraries were constructed from extracted DNA samples with 10 μL (1/5 volume) reactions using the QIAseq FX DNA Library Kit (QIAGEN). Each metagenomic sequencing library was sequenced using the Illumina NextSeq 2000 System 2 x 150 bp configuration.
-
bioRxiv - Molecular Biology 2023Quote: cDNA was produced from 1 μg of total RNA (final cDNA concentration 5 ng/ml) using QuantiTech Reverse Transcription kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... and homogenized twice for 1-5 minutes each at 25Hz using a TissueLyser LT sample disruptor (Qiagen, Part No. 85600) with a 12 tube Tissue Lyser LT adapter (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted from input and IP samples by incubation with 1 mL Trizol at room temperature for 5 minutes and then RNeasy Lipid Tissue Mini Kit (Qiagen) via the manufacturer’s protocol with on-column DNase treatment (Roche) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...
-
bioRxiv - Neuroscience 2022Quote: ... and samples were diluted 1:1 in 70% ethanol and purified using RNeasy columns and reagents (QIAGEN). RNA concentration was measured using a NanoDrop spectrophotometer ...
-
bioRxiv - Systems Biology 2022Quote: ... 12 μl of 1 M Tris-HCl (pH 6.5) and 1 μl RNAse A (Qiagen cat # 19101) were added to the sample and incubated for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 1 × 109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Small pieces of tissue (~1×1 mm) were minced and placed in RLT Plus buffer (QIAgen, 1053393) supplemented with 140 mM 2-mercaptoethanol ...
-
bioRxiv - Bioengineering 2021Quote: ... The 319 bp DNA size of PCR products were clarified by 1% agarose gel electrophoresis using 5 μL PCR products and remained DNA were purified by QIAquick PCR Purification Kit (Qiagen, 28104). The purified PCR products were sequenced by Sanger Sequencing approach (GeneWiz ...
-
bioRxiv - Genetics 2020Quote: ... suspended in 1 mL of (v/v) 50% ACN and homogenized in a bead mill (50 Hz, 5 min; TissueLyser LT, Qiagen, Germany) using two 5 mm tungsten balls ...
-
bioRxiv - Cancer Biology 2024Quote: ... additional DNA from 1-5 mL of plasma was extracted using the QIAamp® Circulating Nucleic Acid Kit (Qiagen, catalogue # 55114). Illumina sequencing libraries were constructed using SRSLY® PicoPlus DNA NGS Library Preparation Kit (ClaretBio – Cat ...
-
bioRxiv - Cell Biology 2024Quote: RNA at the defined stages of differentiation (day 0, 1, 5, 8, 11, 14, 17, 27, 35, 50) was extracted using RNeasy Plus mini kit (Qiagen, 74136) according to the manufacturer’s guidelines ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... They were placed individually into 2 ml microcentrifuge tubes with 1 ml of distilled water and a stainless-steel bead (Ø 5 mm, and homogenised with a Qiagen TissueLyser LT at a frequency of 30 Hz for one minute ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA sequence (5’-GAGUAGAACUAGAAUGUGA-3’) targeting Hec1 was synthesized by Qiagen. The ON-TARGETplus SMARTpool siRNA sequences (5’-GAACGAGUAACCACAAUUA-3’) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...