Labshake search
Citations for Qiagen :
601 - 650 of 1256 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from an aliquot of 3 x 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was isolated from HEK293T cells 3 days after transfections using the Gentra Puregene Cell Kit (Qiagen) and was diluted to 10 ng/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed 3 times with PBS and had their genomic DNA extracted with the QIAamp DNA mini kit (QIAGEN). Sequencing libraries were prepared at GenomeScan (Netherlands ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Cell Biology 2023Quote: siRNA targeting human GPRC5A (siGPRC5A_4 against target sequence 5′-CTGGGTGTGTTGGGCATCTTT-3′, cat# SI04438021) and non-targeting control siRNA (cat# Ctrl_AllStars_1, target sequence not disclosed) were purchased from Qiagen. Human primary keratinocytes were transfected at 20 nM final siRNA concentration using Lipofectamin 2000 reagent (Life Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from 3 dpf zebrafish AB larvae (50 fish) using RNAeasy Plus Kit (Qiagen 74134). cDNA was synthesized using SuperScript IV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed in an Applied Biosystems QuantStudio 3 using the QuantiTect® Multiplex PCR Kit (QIAGEN). The primers and probes used are listed in Table S2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 0 or 3% CSE-treated bronchospheres using the Qiagen RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Microbiology 2023Quote: ... Individual mosquitoes were homogenized for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). DNA extraction of individual larvae was carried out using the QIAamp DNA Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we amplified samples (N=3 of each species) using the PyroMark PCR kit (Catalog #978703, Qiagen, Germantown, MD) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: RNA isolation and qPCR – RNA was isolated from 3 x106 BMMCs using the RNeasy Plus kit (Qiagen, 74136) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and a 3 ml bacterial culture was collected for DNA extraction using the DNeasy Blood & Tissue kit (Qiagen). Sequencing libraries were made and commercially sequenced by Illumina sequencers in SeqCenter (https://www.seqcenter.com/) ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted from 3×106 SYAT or CGR8 cells with the Rneasy Plus Mini Kit (Qiagen, #74134). Reverse transcription was performed on 1 µg RNA using oligodT (Thermo Fisher Scientific #SO131 ...
-
bioRxiv - Bioengineering 2024Quote: ... Total RNA was extracted from 3 mm rings surrounding the initial punch wound using RNeasy Mini kit (Qiagen). The tissues from a pair of ear pinnae from each animal were pooled prior to RNA extraction so that each RNA sample represented one mouse ...
-
bioRxiv - Biochemistry 2024Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was extracted from 3 – 5 x 106 cells using Rneasy kit with Dnase I treatment (QIAGEN), following manufacture instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were purified by immobilized metal affinity chromatography according to the manufacturer’s protocol (Qiagen), followed by gel filtration in 50 mM sodium citrate buffer (pH 5.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The proteins were first purified by chromatography on a Ni-NTA agarose column (QIAGEN), and then further purified on a HiTrap Heparin column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2020Quote: ... Poly-histidine-tagged recombinant proteins were purified using Ni-NTA-Agarose (Qiagen, Hilden, Germany) beads according to manufacturer’s instructions and were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were digested with 30 μL of Proteinase K II (QIAGEN, GmbH, Hilden, Germany). DNA was washed with AW1 and AW2 buffers (QIAGEN ...
-
bioRxiv - Biochemistry 2020Quote: ... The target proteins were purified by affinity chromatography using a Ni-NTA column (Qiagen) with the lysis buffer supplemented with 20 mM and 200 mM imidazole serving as the washing buffer and elution buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... The soluble hEKL proteins were purified using a Ni-NTA agarose resin (Qiagen, Germany) and subsequently HiLoad 16/60 superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Bioengineering 2020Quote: ... The soluble protein fraction was then purified with pre-equilibrated Ni-NTA resin (Qiagen), recovered in elution buffer (100 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was purified by affinity chromatography using Ni-NTA agarose (Qiagen, Hilden, Germany), followed by gel filtration chromatography ...
-
bioRxiv - Cell Biology 2021Quote: ... We purified the 6xHIS fusion protein on nickel-nitrilotriacetic acid agarose (Qiagen, Valencia, CA) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM 2-mercaptoethanol) and the proteins eluted from nickel-NTA agarose beads (Qiagen; using buffer containing 25 mM Tris-HCl (pH 7.6) ...
-
bioRxiv - Biophysics 2022Quote: ... The YB-1 (1-180) protein fragment was purified following the manufacturer’s recommendations (Qiagen). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... tularensis IM protein SecY (Huntley, 2007) or the Penta-His HRP conjugate antibody (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... Recombinant HisCheY or HisCheY* and bound proteins were purified using nickel agarose columns (Qiagen) under native conditions per manufacturers’ instructions.
-
bioRxiv - Biochemistry 2020Quote: ... and proteins were purified by IMAC using Ni-NTA spin columns (QIAGEN, Hilden, Germany). Proteins were eluted in 100 μL elution buffer (50 mM sodium phosphate pH 8.0 ...
-
bioRxiv - Bioengineering 2020Quote: ... and recombinant proteins were isolated from the periplasmic fraction using Ni-NTA beads (Qiagen). Following washing and subsequent elution with 50 mM Tris (pH 8) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Uncleaved protein with 6xHisTag were isolated from the lysate using Ni-NTA resin (Qiagen). The flow-through (FT ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged proteins were incubated with Nickel-nitrilotriacetic acid (NTA) sepharose (Qiagen, Hilden, Germany) at 4°C with slight shaking for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... His-βC1 fusion proteins were purified using Ni-nitrilotriacetate (Ni-NTA) agarose (Qiagen, 30210) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... His-tagged proteins from the supernatant were incubated overnight with Ni-NTA agarose (Qiagen) at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... and associated protein network by using Ingenuity® Pathway Analysis (IPA) software (QIAGEN Inc.), relying on IPA’s proprietary algorithm to evaluate and minimize sample source bias ...
-
bioRxiv - Immunology 2021Quote: ... and recombinant proteins produced in the supernatant were purified using Ni-NTA agarose (QIAGEN). To biotinylate RBD proteins ...
-
bioRxiv - Physiology 2021Quote: ... Total RNA was extracted from EVs (20 μg protein) using miRNeasy Mini Kit (Qiagen). RNA was then reverse-transcribed using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... The proteins were purified by affinity chromatography using a Ni-NTA agarose resin (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... The secreted protein in the culture supernatant was purified using Ni-NTA agarose (Qiagen) according to the manufacturer’s protocol and dialyzed against PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were equalized for protein concentration and incubated with NiNTA agarose beads (Qiagen, #L30210) for O/N ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was purified using Ni-NTA agarose beads according to the manufacturer’s instructions (Qiagen). A buffer exchange was performed by centrifugation of the protein preparation through an Amicon Ultra-15 centrifugal filter unit (Millipore ...
-
bioRxiv - Bioengineering 2020Quote: ... The enriched proteins were searched again Ingenuity pathway analysis (QIAGEN, Redwood City, CA, USA) for their primary subcellular location and enriched molecular functions ...