Labshake search
Citations for Qiagen :
551 - 600 of 3853 citations for 7 trifluoromethyl 1 2 3 4 tetrahydro 5 nitroisoquinoline hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
bioRxiv - Plant Biology 2020Quote: ... The clear supernatant was then gently mixed with 1 ml of Ni+2-NTA agarose beads (Qiagen, Germany) for 30 min and then added to the column with a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Immunology 2020Quote: ... Pellets were lysed by vortexing for 1 minute in 350uL cold supplemented RLT buffer (RLT + β-MeOH) at 4°C and lysates homogenized using QIAshredder columns (Qiagen). RNA was then extracted from these samples using the RNeasy Plus Micro kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which we select the top 250 genes for which the correlation coefficient was positive and the top 250 genes for which the correlation coefficient was negative. The final step of the pipeline (Fig. 1 (4)) analyzes these genes by using Ingenuity Pathway Analysis (IPA, QIAGEN, [27]) to interpret the canonical pathways.
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5μl of diluted cDNA (1:3 - nuclease-free water) was used as template in 10μl real-time PCR reactions (Qiagen: ‘SYBR Green PCR kit’) to assay specific transcripts (BioRad ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 µg of RNaseA (Qiagen 28306) overnight as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Immunology 2019Quote: ... mucosal scrapings and feces were homogenized in a 2 ml eppendorf containing 1 ml of DNA extraction buffer and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted from 1∼5 million PBMCs into 30ml of water with RNeasy Mini Kits (Qiagen, Valencia, CA). For unbiased repertoire analysis ...
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.5-1 μg of total RNA was reverse transcribed into first-strand cDNA using an RT2 First Strand Kit (QIAGEN). The resultant cDNA was subjected to qPCR using human cytokine-specific primer (Realtimeprimers.com ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA was separated on a 1% agarose gel and the ∼5 Kb genomic DNA band was harvested with a QIAquick Gel Extraction Kit (Qiagen). The DNA library was prepared according to the manual of the Ligation Sequencing Kit (Nanopore) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed by boiling (5 min 95°C) followed by bead beating (3mm beads, 30 Hz for 1 min) (TissueLyser II, Qiagen) and sonication bath (3×10 sec at 4°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... several loci were amplified simultaneously from 1 μl of extracted DNA using 5 μl of the Multiplex PCR Master Mix (Qiagen) and varying amounts of the pooled primer mixes (Pool A ...
-
bioRxiv - Microbiology 2021Quote: ... samples were weighed and homogenized in DMEM containing 10% FBS and 1% antibiotics using 5 mm stainless steel beads (Qiagen) and the TissueLyser II (Qiagen) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... grown over night in 5 mL LB and 100 μg mL-1 ampicillin and DNA were purified using a QIAprep Spin Miniprep Kit (QIAGEN). Sequencing was performed by GATC using the primers in SI Appendix Table S4 ...
-
bioRxiv - Immunology 2022Quote: ... and homogenized twice for 1-5 minutes each at 25Hz using a TissueLyser LT sample disruptor (Qiagen, Part No. 85600) with a 12 tube Tissue Lyser LT adapter (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... The bead-bound gDNA was isothermally amplified for 3 hours at 30 °C then 10 minutes at 65 °C using a miniaturised (1/5 vols) Repli-g Single-Cell assay (Qiagen). The amplified gDNA was cleaned up with 0.8 × vols Ampure XP and 80 % ethanol ...
-
bioRxiv - Molecular Biology 2023Quote: cDNA was produced from 1 μg of total RNA (final cDNA concentration 5 ng/ml) using QuantiTech Reverse Transcription kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Metagenomic sequencing libraries were constructed from extracted DNA samples with 10 μL (1/5 volume) reactions using the QIAseq FX DNA Library Kit (QIAGEN). Each metagenomic sequencing library was sequenced using the Illumina NextSeq 2000 System 2 x 150 bp configuration.
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated from the VTM in a biosafety level-3 (BSL-3) laboratory using QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA from h-iECs which have been expanded for 7 days was extracted using Rneasy Mini Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... and their bat orthologues [(Pteropus alecto (XP_006907484.1) and Desmodus rotundus (XP_024413747.1)] were subjected to multiple alignment using CLC workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark).
-
bioRxiv - Microbiology 2021Quote: RNA was extracted from ME49 Δhxgprt::Fluc tachyzoites and bradyzoites induced for 7 days at pH 8.2 using RNeasy Mini Kit (Qiagen) combined with QIAshredder (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... A neighbour-joining tree was built using the Jukes-Cantor nucleotide distance model and 1,000 bootstraps in CLC Sequence Viewer 7 (Qiagen).
-
bioRxiv - Microbiology 2020Quote: DNA for metagenomic sequencing was extracted from ~7 g sediment (~0.7 g sediment in 10 individual lysis tubes) using PowerSoil DNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the samples were run in the ViiA 7 Real-Time PCR System with the QuantiTect SYBR Green (Qiagen, 204143) (2017) ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA was harvested from post-transfection HuH-7 cells using the DNeasy Blood & Tissue Kit (Qiagen, catalog #69506). Similarly ...
-
bioRxiv - Immunology 2023Quote: M1 and M2 macrophages (300,000/well, 96-well plate) were transfected on Day 7 with MALAT1 or control GapmeRs (Qiagen). MALAT1- or control GapmeR-transfected M1 and M2 Mφ were incubated with Texas Red-conjugated Ova and DQ-conjugated Ova (both 1 mg/ml ...
-
bioRxiv - Immunology 2023Quote: ... GC B cells (Live/Dead-CD19+IgD-CD95+GL-7+) and naïve B cells (Live/Dead-CD19+IgD+) were flow sorted into RLT Plus buffer (Qiagen) following pre-enrichment with the Pan B Cell Isolation Kit II (Miltenyi) ...
-
bioRxiv - Plant Biology 2022Quote: ... using 3-mm steel beads (Cat No.: 69997, Qiagen); tubes were shaken for 20-s at 28 Hz with dry ice.
-
bioRxiv - Evolutionary Biology 2022Quote: ... with two sterile 3 mm beads (Qiagen, Hilden, Germany) and a bead device at 20 Hz for 3 min ...
-
bioRxiv - Immunology 2020Quote: ... and prepared the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). 10ng purified RNA was used for the NGS libraries ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in 3 volumes RLT buffer (Qiagen) and RNA was extracted using Dynabeads MyOne Silane (Life technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). After vigorous mixing with chloroform at a 1:4 v/v ratio (chloroform:TRIzol) ...
-
bioRxiv - Genomics 2021Quote: ... 3 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template containing cDNA ...
-
bioRxiv - Immunology 2023Quote: ... using tungsten carbide beads (3 mm, Qiagen catalog #69997) and shaking (300 times per min ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3 min in TissueLyser II (30 Hz; Qiagen). Cell lysates were centrifuged for 15 min (4 °C ...
-
bioRxiv - Physiology 2023Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). Lysates were centrifuged for 15 min (21,000 g ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 volumes of QIAzol® (Qiagen, Cat. No. 79306) were added to 80 µl of cell extracts ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 μL of Ni-NTA (Qiagen) slurry was added and the solution was incubated with light agitation at 4 °C for 50 min ...