Labshake search
Citations for Qiagen :
801 - 850 of 3853 citations for 7 trifluoromethyl 1 2 3 4 tetrahydro 5 nitroisoquinoline hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM primers and 1 μl DNA template ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM Primer and 1 μl DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl Polyfect Transfection Reagent (Qiagen, catalog # 301105) was added ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 mm stainless steel beads (Qiagen, #69989). Lysates were incubated for 2 h at 37°C protected from light ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA was extracted from 1-to 2-mm-long tail tips using the DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). Genomic DNA (5 μl ...
-
bioRxiv - Cell Biology 2020Quote: ... The qPCR was performed using the TaqMan™ RNA-to-CT™ 1-Step kit (Thermo Fischer Scientific) and was run in a RotorGene-6000-2-plex (Qiagen). PCR conditions having reverse transcription at 48’C for 15 min ...
-
bioRxiv - Immunology 2022Quote: ... of soluble SARS-CoV-2 WA1 and SARS-CoV-2 Omicron BA.1 spike trimers were isolated from cell supernatants using a Ni-NTA column (Qiagen, Hilden, Germany). Eluents from Ni-NTA purifications were subjected to SEC using a HiLoad Superdex 200 16/600 column followed by a Superose 6 10/300 (Cytiva ...
-
bioRxiv - Microbiology 2023Quote: ... we placed filters in 2 mL tubes with beads and 1 mL TE buffer (Qiagen plasmid isolation kit, Qiagen Germantown, MD, USA) and ran them in the tissue lyser at either ½ speed or max speed for 30 sec or 1 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... The supernatant was loaded over 3 ml of Ni-NTA beads (Qiagen) equilibrated in lysis buffer ...
-
bioRxiv - Immunology 2019Quote: ... and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH; all primers from Qiagen).
-
bioRxiv - Evolutionary Biology 2019Quote: ... An additional bead-beating step using 3 mm carbide beads (Qiagen, UK) in a Qiagen tissue lyzer (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against 3’UTR sequence of mouse Alr were purchased from Qiagen. siRNAs were transfected into HEK293 or MEF using Dharmafect 1 Transfection Reagent (Dharmacon) ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... the 3’ adaptor sequence (AACTGTAGGCACCATCAAT) was trimmed based on vendor’s recommendation (Qiagen). After adaptor trimming ...
-
bioRxiv - Microbiology 2023Quote: ... then resuspended in 3 mL of RNAprotect for bacterial cells (Qiagen, #76506). Planktonic cultures were similarly pelleted and resuspended in RNAprotect ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then applied to a 3 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated overnight with 3 ml Ni-NTA beads (Qiagen) preequilibrated with the extraction buffer ...
-
bioRxiv - Immunology 2023Quote: Tissue was homogenized by using sterile 3-mm tungsten carbide beads (QIAGEN) in a TissueLyser II (QIAGEN ...
-
bioRxiv - Developmental Biology 2023Quote: ... tailbuds were individually lysed in 3 μL of RLT + BME (Qiagen RNeasy) and stored in separate PCR tubes at –80 °C to await genotyping of heads (for rad21-/- and rad21+/-) ...
-
bioRxiv - Cell Biology 2023Quote: ... mRNA was isolated from 3 dpf TL larvae (RNeasy, Qiagen; RNAlater, Invitrogen), and AffinityScript QPCR cDNA Synthesis Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... the tissue samples were homogenised using 3 mm stainless steel beads (Qiagen) and a TissueLyser II (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: Colon tissue fragments (3 mm, proximal colon) were stored in RNAlater (Qiagen) overnight at 4c ...
-
bioRxiv - Genomics 2019Quote: ... are prepared as follows: 4 µL of Vapor-Lock (Qiagen) is manually added to each well using a multichannel pipette followed by 2 µL of lysis buffer (0.2 µL of 25 µg/µL Qiagen Protease ...
-
bioRxiv - Pathology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen 741-4) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and WNT signaling targets PCR array (Qiagen, PAMM 243ZE-4) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... and incubated with 4 mg/mL RNase A (Qiagen 158922) diluted 1:286 in 2X SSC for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Microbiology 2020Quote: ... 4) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) by the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subsequently normalized to 4 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Systems Biology 2019Quote: ... Approximately ∼50 mg frozen tissue was pulverised in methanol-chloroform (300 µl, 2:1 v/v) using a TissueLyser (Qiagen, West Sussex, UK). Then the mixture was sonicated for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA from untreated or RSL3-treated (with or without 2 hr pre-treatment with 2 µM Ferrostatin-1) MM1S and MM1R cells was extracted using the RNeasy Mini Kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from all samples (5 CTRL and 5 SCZ subjects at six timepoints across astrocyte differentiation) using either the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) or the MagMax mirVana Total RNA Isolation Kit (Thermo Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.1 g of tissue per 1 mL of PBS was homogenized with stainless steel beads of 5 mm (25–30 Hz for 5 min) by a Tissuelyser (Qiagen, Venlo, Netherlands). The homogenates were centrifuged at 10,000 x g for 10 min and the supernatant was collected and stored at −80 °C until CD quantification ...
-
bioRxiv - Microbiology 2024Quote: ... IFAS and LifeGuard Soil Preservation were transferred into a 5 mL bead beating tube from DNeasy PowerWater kits for 5-minutes of vortexing (Qiagen, Hilden, Germany). Afterwards ...
-
bioRxiv - Developmental Biology 2021Quote: ... we added a 5-mm stainless steel bead (QIAGEN) and 100 μl of PBS to each tube and lysed the samples by TissueLyser II (QIAGEN ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg total RNA was treated with DNase (Qiagen) and purified (RNeasy Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... A single sterile 5 mm stainless steel bead (Qiagen) was added to each tube ...