Labshake search
Citations for Qiagen :
551 - 600 of 4243 citations for 6 methyl 4 oxo N phenyl 2 3 dihydro 1 4 oxathiine 5 carboxamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells in 6-well plates were transfected with 2 μg pIRES2-eGFP or Trim-HA-NUP153 derivatives using Effectene (Qiagen). At 24 h post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA of the 20 Jan and 3 Mar 2021 samples (1/3 pellet) was extracted with the DNeasy UltraClean Microbial Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lysed (1.28 M sucrose, 40 mM Tris-HCl [pH 7.5], 20 mM MgCl2, and 4% Triton X-100; Qiagen) and digested (800 mM guanidine–HCl ...
-
bioRxiv - Genomics 2020Quote: Nucleic acids were isolated from 4 mL of plasma by using a QIAamp cfDNA/RNA kit (Qiagen 55184) following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: Liver homogenates were prepared in cold conditions (+4°C) by adding a stainless-steel bead (Qiagen, cat. 69989) and tissue lysis buffer (composition ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA of spleens (4 samples per group) was isolated with the QIAGEN miRNeasy mini extraction kit (QIAGEN) and cDNA was synthesized with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
Deconstructing the role of iron and heme in the structure of healthy human gut microbial communitiesbioRxiv - Microbiology 2022Quote: ... 50 µL of saturated bacterial cultures were extracted using a DNeasy UltraClean 96 Microbial Kit (Qiagen, 10196-4).
-
Deconstructing the role of iron and heme in the structure of healthy human gut microbial communitiesbioRxiv - Microbiology 2022Quote: ... PCR products were individually cleaned up and quantified using the UltraClean 96 PCR Cleanup Kit (Qiagen 12596-4) and the Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120 ...
-
bioRxiv - Pathology 2020Quote: ... diffracting crystals of P1_102-157 were obtained at 4°C from condition 7 of the Classic kit (Qiagen) containing 0.1 M tri-Sodium citrate pH 5,6 ...
-
bioRxiv - Cell Biology 2019Quote: ... knockdown of KCNB1 expression in human cells was carried out using a mixture of 4 siRNA duplexes (Qiagen; Cat# ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 0.6 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture (1 ml beads per 1 l expression culture was used in case of Drosophila BiP ...
-
bioRxiv - Biophysics 2019Quote: ... The SpyTag-(Cpa)4-SpyTag and the HaloTag-SpyCatcher constructs were cloned into the expression plasmid pQE80L (Qiagen). Protein expression and purification was done as described elsewhere36 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1.28 M sucrose, 40 mM Tris-Cl, pH 7.5, 20 mM MgCl2, and 4% Triton X-100; QIAGEN) and then digested by digestion buffer (QIAGEN buffer G2 ...
-
bioRxiv - Microbiology 2022Quote: ... 14 μL of filtered supernatant was combined with 4 μL of RDD buffer (Qiagen, RNase-Free DNase Set) and 2 μL of DNase I and dissolved as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were lysed (1.28 M sucrose, 40 mM Tris-HCl [pH 7.5], 20 mM MgCl2, and 4% Triton X-100; Qiagen) and digested (800 mM guanidine–HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 minutes 4°C and the supernatant was incubated with pre-equilibrated Ni-NTA agarose beads (Qiagen, #1018244) with shaking on ice for 3 hours ...
-
bioRxiv - Molecular Biology 2023Quote: We also used the RT2 Profiler PCR array mouse fibrosis (cat. #PAMM 120-ZE-4) kit from Qiagen to detect the expression of 84 fibrosis-related genes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 sections 10 µm thick were placed in a chilled Eppendorf tube and RNA extraction protocol from Qiagen was performed (Rneasy FFPE Kit 73504 ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was isolated from CTi400 and N/TERT-1 cells using RNeasy Plus mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Genomics 2020Quote: ... cells were mixed 1:2 with RNAProtect (Qiagen) and harvested via centrifugation ...
-
bioRxiv - Cell Biology 2019Quote: ... accordingly to manufacturer’s instructions using non-targeting siRNA (siCtrl; 5’-AATTCTCCGAACGTGTCACGT-3’) and siRNA targeting Cav1 (SI00299635 and SI00299628) from Qiagen, or using pre-miR-NC (negative control ...
-
bioRxiv - Developmental Biology 2019Quote: ... The TSB (5’-ATTATTGCACCCAGTGCC-3’: the miR-92a-3p target site is underlined) was designed and produced by Qiagen, with an additional scrambled TSB to act as a negative control (5’-TAACACGTGTATACGCCCA-3’) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNAs from batch of 3-5 embryos were extracted with the Rneasy® Micro Kit (Qiagen, Valencia CA). Relative quantitative PCR was performed on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates or in wells of a 6-well plate using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... in vitro derived Foxp3+ cells were harvested on day 2 and day 6 into Trizol and total RNA was isolated with miRNeasy Micro Kits (QIAGEN 217084) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
Epigenetic Effects of Exposure to Insecticide on Early Differentiation of Mouse Embryonic Stem CellsbioRxiv - Pharmacology and Toxicology 2019Quote: DNA methylation was evaluated using an EpiTect Methyl II DNA Kit provided by Qiagen (Chatsworth, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: RNA was isolated from ∼100,000 MSNs from 4 independent differentiations per experimental group according to the manufacturer’s protocol and purified using RNeasy columns (Qiagen). A total of 72 mRNA libraries for Illumina sequencing were prepared using KAPA mRNA HyperPrep Kit (KAPA Biosystems ...
-
bioRxiv - Genetics 2019Quote: ... cells (from 4 × 104 to 2.3 × 106) were pelleted at 400xg for 4 min and resuspended in 700 μL RLT buffer (Qiagen) with beta-mercaptoethanol (1:100) ...