Labshake search
Citations for Qiagen :
5201 - 5250 of 10000+ citations for Mouse ATP Synthase Coupling Factor 6 Mitochondrial ATP5J ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Cellular RNA was isolated using the RNeasy kit (Qiagen) with on-column DNase digestion ...
-
bioRxiv - Immunology 2024Quote: ... Cellular RNA was isolated with the RNeasy kit (Qiagen) with on-column DNase digestion ...
-
bioRxiv - Microbiology 2024Quote: ... we followed the QIAamp DNA stool mini kit (Qiagen)-based protocol described by Knudsen et al ...
-
bioRxiv - Bioengineering 2023Quote: ... and purified with the MinElute Gel Extraction Kit (Qiagen). For each sample ...
-
bioRxiv - Cell Biology 2024Quote: ... utilizing the RNeasy Plus Mini kit (Qiagen, Hilden, Germany). Reverse transcription was carried out using the iScript cDNA Synthesis Kit (BIO-RAD ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were purified using MiniElute PCR purification kit (Qiagen) and eluted in 10 µl of elution buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... and purified using the miRNeasy micro kit (Qiagen, 217084) with on-column DNase I treatment (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: RNA was extracted employing the RNeasy kit (Qiagen, Germany). For mRNA detection ...
-
bioRxiv - Genomics 2023Quote: ... or with the QIAquick PCR Purification Kit (Qiagen, 28106) with 30 µL elution buffer.
-
bioRxiv - Physiology 2023Quote: ... RNA was isolated using RNeasy Mini Kit (Qiagen #74106) according to manufacturer’s instructions ...
-
Convergence, plasticity, and tissue residence of regulatory T cell response via TCR repertoire prismbioRxiv - Immunology 2023Quote: ... RNA purification from individual samples (RNeasy Micro Kit, Qiagen), TCR library preparation from cDNA and Library Next Generation Sequencing has been previously described18.
-
bioRxiv - Cancer Biology 2024Quote: ... vectors were prepared using the EndoFree-Maxi Kit (Qiagen) and resuspended in a sterile 0.9% NaCl solution/plasmid mix containing 10 μg of pT3-MYC (Addgene #92046) ...
-
bioRxiv - Biochemistry 2024Quote: ... and purified using a QIAquick Gel Extraction Kit (Qiagen). The forward PCR primer (5’-GAAAAACTGGATCGTCTGAAAGCCCGGGCTTAAGGATAAGAACTAACGTGATTCC GGGGATCCGTCGACC-3’ ...
-
bioRxiv - Bioengineering 2024Quote: ... genomic DNA was isolated using a DNeasy kit (QIAGEN). Indels were identified by PCR of the region of interest (Tables S3) ...
-
bioRxiv - Bioengineering 2024Quote: ... homogenization columns and isolation kits were purchased from Qiagen. Bioanalyzer chips and reagents were purchased from Agilent ...
-
bioRxiv - Bioengineering 2024Quote: ... RNA was extracted using an RNeasy Mini Kit (Qiagen) and the concentration was evaluated with a NanoDrop OneC (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Ni-NTA Agarose (part of QIAexpress Kits, Qiagen (Germany) was used.
-
bioRxiv - Biochemistry 2023Quote: ... MN (Germany) or Plasmid Midi kits from Qiagen (Germany).
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated using RNeasy Plus Mini Kit (Qiagen), and cDNA was prepared using Superscript First Strand Synthesis System for RT-PCR Kit (Biorad ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was isolated using the RNeasy kit (Qiagen) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA was isolated using QIAamp DNA kit (Qiagen) and used for DNA methylation profiling.
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted using RNeasy micro-kit (Qiagen) following manufacturer’s procedures ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was extracted using the RNeasy Micro kit (Qiagen) following the manufacturer’s recommendations ...
-
bioRxiv - Synthetic Biology 2023Quote: ... overnight and PCR purified (Qiagen QIAQuick PCR Purification Kit) the following day ...
-
bioRxiv - Genomics 2023Quote: We used the DNEasy Blood and Tissue Kit (Qiagen) to extract 5 ug DNA from the GM12878 lymphoblastoid cell line ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using QIAquick PCR Purification Kit (QIAGEN).
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted using the DNeasy PowerSoil Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated using the miRNeasy Mini Kit (Qiagen) and cDNA was synthesized using SuperScript IV Reverse Transcriptase ...
-
bioRxiv - Microbiology 2023Quote: The QIAamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany) was used for the DNA extraction of FFPE embedded tissue sections ...
-
bioRxiv - Microbiology 2023Quote: ... the RNeasy Lipid Tissue Mini Kit (Qiagen, Hilden, Germany) was applied and a DNase digestion was carried out by using the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... gel purified using the QIAquick Gel Extraction Kit (Qiagen), ligated with phosphorylated oligonucleotides ...
-
bioRxiv - Immunology 2023Quote: ... RNA isolation was performed using RNeasy Mini Kit (Qiagen) and was quantified using a Qubit 4 fluorometer (ThermoFisher) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were processed for RNA (RNeasy micro kit, Qiagen) and reverse transcribed to cDNA (SuperScript First Strand Synthesis Kit for RT-qPCR ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was extracted using RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions and converted to cDNAs employing RT2 HT First Strand cDNA Kit (Qiagen) ...
-
bioRxiv - Genetics 2023Quote: ... and EZ1 DNA Tissue Kit (Qiagen Catalog No. 953034). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... RNAs were purified using an RNeasy mini kit (QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated using the RNA Mini Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids were isolated with a QIAprep Miniprep Kit (Qiagen) and quantified using 260 nm/280 nm absorbance on a Biotek Synergy H1 plate reader ...
-
bioRxiv - Neuroscience 2023Quote: mRNA was isolated using the RNeasy Mini kit (Qiagen) and sequence libraries were prepared by Admera Health (www.admerahealth.com ...
-
bioRxiv - Genetics 2023Quote: ... The products were gel-purified (QIAGEN Gel Extraction Kit) and eluted in 15 μL EB in a MinElute Column (QIAGEN) ...
-
bioRxiv - Immunology 2023Quote: ... and used for RNA extraction (RNeasy Mini Kit, Qiagen). RNAseq analysis was performed by LC Sciences (Houston ...
-
bioRxiv - Microbiology 2023Quote: ... or QuantiNova SYBR Green RT-PCR Kit (Qiagen, MD) per manufacturer’s protocol on a QuantStudio 3 (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... minus isolates using a DNeasy Plant Maxi Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using RNeasy MinElute Cleanup Kit (Qiagen, Germany). Genomic DNA was then removed using DNase I (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was purified with the RNAeasy mini kit (Qiagen) according to manufacturer instruction (from step 4 of the protocole Part 1) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Plasmids were extracted via QIAprep spin miniprep kit (Qiagen) and quantitated using absorbance at 260 nm using a Nanodrop spectrophotometer ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was cleaned by QIAquick Gel extraction kit (Qiagen). The DNA further was cleaned with NaOAc/ EtOH method ...
-
bioRxiv - Molecular Biology 2022Quote: RNA extraction was performed using RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was extracted using a RNeasy kit (#74104, QIAGEN) at the same time and date for all mice belonging to a single experimental cohort (i.e. ...
-
bioRxiv - Evolutionary Biology 2022Quote: Genomic DNA was isolated (Qiagen Fast kits; Qiagen Inc.) and quantified by fluorometry (Qubit ...