Labshake search
Citations for Qiagen :
5101 - 5150 of 10000+ citations for Mouse ATP Synthase Coupling Factor 6 Mitochondrial ATP5J ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... PolyA selected RNA was isolated using Oligotex kit (QIAGEN) and further processed with SMARTer Stranded RNA-Seq Kit (Takara ...
-
bioRxiv - Microbiology 2024Quote: ... using the QIAamp DNA Mini Kit (Qiagen, Germantown, MD) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The DNeasy® PowerFood® Microbial Kit (QIAGEN, Germany) was used following the manufacturer’s instructions with minor exceptions ...
-
Assessment of salivary microRNA by RT-qPCR: Challenges in data interpretation for clinical diagnosisbioRxiv - Molecular Biology 2024Quote: Reverse transcriptase reactions using miRCURY LNA RT Kit (Qiagen) for synthetic and/or purified salivary miRNA were prepared in 96 well plates ...
-
bioRxiv - Synthetic Biology 2024Quote: ... gel extractions using the QIAquick Gel Extraction Kit (QIAGEN) and PCR clean-up reactions using the MinElute PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Biochemistry 2023Quote: ... Ni-NTA Agarose (part of QIAexpress Kits, Qiagen (Germany) was used.
-
bioRxiv - Biochemistry 2023Quote: ... MN (Germany) or Plasmid Midi kits from Qiagen (Germany).
-
bioRxiv - Bioengineering 2024Quote: ... RNA was extracted using an RNeasy Mini Kit (Qiagen) and the concentration was evaluated with a NanoDrop OneC (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated using RNeasy Plus Mini Kit (Qiagen), and cDNA was prepared using Superscript First Strand Synthesis System for RT-PCR Kit (Biorad ...
-
bioRxiv - Cell Biology 2023Quote: RNA was extracted employing the RNeasy kit (Qiagen, Germany). For mRNA detection ...
-
bioRxiv - Cell Biology 2023Quote: ... and purified using the miRNeasy micro kit (Qiagen, 217084) with on-column DNase I treatment (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... or with the QIAquick PCR Purification Kit (Qiagen, 28106) with 30 µL elution buffer.
-
bioRxiv - Physiology 2023Quote: ... RNA was isolated using RNeasy Mini Kit (Qiagen #74106) according to manufacturer’s instructions ...
-
Convergence, plasticity, and tissue residence of regulatory T cell response via TCR repertoire prismbioRxiv - Immunology 2023Quote: ... RNA purification from individual samples (RNeasy Micro Kit, Qiagen), TCR library preparation from cDNA and Library Next Generation Sequencing has been previously described18.
-
bioRxiv - Biochemistry 2024Quote: ... and purified using a QIAquick Gel Extraction Kit (Qiagen). The forward PCR primer (5’-GAAAAACTGGATCGTCTGAAAGCCCGGGCTTAAGGATAAGAACTAACGTGATTCC GGGGATCCGTCGACC-3’ ...
-
bioRxiv - Bioengineering 2024Quote: ... genomic DNA was isolated using a DNeasy kit (QIAGEN). Indels were identified by PCR of the region of interest (Tables S3) ...
-
bioRxiv - Bioengineering 2024Quote: ... homogenization columns and isolation kits were purchased from Qiagen. Bioanalyzer chips and reagents were purchased from Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... vectors were prepared using the EndoFree-Maxi Kit (Qiagen) and resuspended in a sterile 0.9% NaCl solution/plasmid mix containing 10 μg of pT3-MYC (Addgene #92046) ...
-
bioRxiv - Cell Biology 2024Quote: ... utilizing the RNeasy Plus Mini kit (Qiagen, Hilden, Germany). Reverse transcription was carried out using the iScript cDNA Synthesis Kit (BIO-RAD ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA was isolated using QIAamp DNA kit (Qiagen) and used for DNA methylation profiling.
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted using RNeasy micro-kit (Qiagen) following manufacturer’s procedures ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was extracted using the RNeasy Micro kit (Qiagen) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were purified using MiniElute PCR purification kit (Qiagen) and eluted in 10 µl of elution buffer ...
-
bioRxiv - Microbiology 2024Quote: ... total RNA was isolated using RNeasy Mini Kit (QIAGEN) from Pa PAO1 cultures grown until mid-log phase in BMM either supplemented with 5 mM CaCl2 ...
-
bioRxiv - Microbiology 2024Quote: ... we used the DNeasy PowerSoil Pro kit (QIAGEN, 47016) and followed the manufacturer’s standard protocol included in the kit using 100μl of the bacterial culture ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted using RNeasy Mini Kit (QIAGEN) guided by the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: RNA was extracted with the RNeasy Mini Kit (Qiagen), according to a modified version of the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... was extracted by using RNeasy Plus Mini Kit (Qiagen), and 1 µg total RNA from each sample was reverse-transcribed using RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific™ ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA isolation was performed with RNeasy kit (Qiagen). The RNA integrity and concentration was checked using Qubit and 2200 TapeStation (Agilent) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was isolated with the RNeasy mini kit (Qiagen). 1000 ng of RNA from each sample was transcribed to cDNA with FIREScript reverse transcriptase (Solis Biodyne ...
-
bioRxiv - Molecular Biology 2024Quote: ... hepatica adult parasites using the miRNeasy Mini Kit (Qiagen) as previously described [30] and cDNA synthesized using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were purified by using Spin Miniprep Kit (Qiagen). Sequencing (Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA extraction was performed with RNeasy Mini kit (QIAGEN) and reverse-transcription with High-Capacity cDNA Reverse Transcription kit (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmids were isolated using the Plasmid Midi Kit (Qiagen).
-
bioRxiv - Physiology 2024Quote: ... Total RNA was isolated using RNeasy Mini Kit (Qiagen) after lysis in RLT buffer with bead homogenization ...
-
bioRxiv - Paleontology 2024Quote: ... The DNeasy PowerSoil Pro Kit (Qiagen, Germantown, MD, USA), one of the most common kits for the extraction of DNA from sedimentary environments ...
-
bioRxiv - Genomics 2024Quote: ... and purified using a QIAquick gel extraction kit (Qiagen). The linearized vector was assembled with the amplified oligo pool using the NEBuilder HiFi DNA assembly kit (NEB ...
-
bioRxiv - Immunology 2024Quote: ... equi using DNeasy Blood & Tissue Kit (Qiagen, Hilder, Germany). We determined DNA quality and quantity via spectrophotometer (Nanodrop 1000 ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was purified using the RNeasy kit (Qiagen) or ISOGEN reagent (Nippongene ...
-
bioRxiv - Genomics 2024Quote: ... the DNeasy Blood & Tissue Kit (Qiagen, Cat. No. #69506) was used as per the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was isolated using a RNeasy kit (Qiagen) and RT-qPCR was performed as previously described (Egea et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... and purified using the miRNeasy Mini Kit (Qiagen; 217004). A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’ ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated using the RNeasy kit (Qiagen), followed by synthesis for cDNA with a reverse transcription reaction (Quantitect® Reverse Transcription kit) ...
-
bioRxiv - Neuroscience 2024Quote: RNA was isolated using the RNeasy kit (Qiagen, 74104) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted using the miRNeasy mini kit (Qiagen), with the modification that two RWT washes were performed ...
-
bioRxiv - Microbiology 2024Quote: ... A QuantiTect Reverse Transcription Kit (Cat. no. 205313, Qiagen) was used for cDNA synthesis and Quantitative RT-qPCR was performed using a QuantiNova SYBR Green RT-PCR Kit (Cat ...
-
bioRxiv - Microbiology 2024Quote: ... gDNA was isolated using DNeasy Blood & Tissue Kit (QIAGEN). WGS was conducted using Illumina NovaSeq 6000 s4 system with 2×150 bp paired-end technique.
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted using RNeasy Lipid Tissue Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Small RNA was extracted using miRNeasy kit (Qiagen, 217004). In brief ...
-
bioRxiv - Molecular Biology 2023Quote: ... and repurified using the RNeasy micro plus Kit (Qiagen). Total RNA and library integrity were verified on LabChip Gx Touch 24 (Perkin Elmer) ...