Labshake search
Citations for Qiagen :
451 - 500 of 580 citations for Polyoxymethylene Homopolymer 20% PTFE Fiber Filled Granule since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Twenty-four hours post injection embryos were assessed for toxicity and genomic DNA was extracted from 20 normally developing embryos using the Qiagen DNeasy Blood and Tissue kit (Qiagen). Injections were performed in three independent replicates.
-
bioRxiv - Bioengineering 2023Quote: ... the cells were pelleted at 15000 g at 4 °C for 30 minutes and the supernatant was supplemented with 20 mM of imidazole before loading onto 1 mL bed volume of Ni-NTA agarose beads (Qiagen) pre-washed with 5 column volumes of 1x TBS (pH 7.3) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from Day 11 populations (n=20, 5/treatment) using Qiagen DNeasy Blood and Tissue Kit (Qiagen, Germany) adapted from the manufacturer’s instructions to include a lysostaphin lysis step(50) ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were collected continuously into 50 mL conicals containing 20 mL RNAlater (saturated ammonium sulfate, 20mM EDTA, pH 5.2; QIAGEN #76106) and a stirring magnetic stir disc (V&P Scientific #772DP-N42-5-2) ...
-
bioRxiv - Microbiology 2024Quote: De novo reconstruction of plasmid sequences was performed by first isolating high molecular weight DNA with the Qiagen Genomic-tip 20/G protocol (Qiagen). Libraries were constructed using the Rapid Barcoding kit (Oxford Nanopore Technologies (ONT) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The medium was thoroughly aspirated and replaced with 20 µl of 1x PBS containing 5 mg/ml of RNase A (Qiagen) and 12 mM of purified H6-mNeonGreen-NLS protein as a loading control ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction was then split into two 20 µl aliquots and each filtered using a single DyeEX column (QIAGEN #63206) to remove salts and iodine ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... gDNA extraction was performed from a freshly dissected piece from the middle body using the Genomic-tip 20/G (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA of the 20 Jan and 3 Mar 2021 samples (1/3 pellet) was extracted with the DNeasy UltraClean Microbial Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted from 1mm diameter tissue punches of approximately 20 μg of frozen brain tissue using the QIAcube Connect with an RNeasy micro kit (Qiagen) and assessed for suitable mass using an Agilent TapeStation System ...
-
bioRxiv - Immunology 2024Quote: Heart tissue was harvested from mice and 20-30mg chunks were subjected to total RNA extraction using the RNeasy Plus Mini kit (Qiagen), and subsequent cDNA preparation was carried out with the iScript cDNA Synthesis kit (Bio-Rad) ...
-
bioRxiv - Immunology 2024Quote: ... Nuclei pellets were centrifuged 20 min at 6000g and processed immediately for gDNA extraction with QIAamp DNA Micro Kit (Qiagen) following manufacture instructions ...
-
bioRxiv - Microbiology 2024Quote: ... mice were perfused with 20 ml of ice cold PBS and the collected organs were homogenized in QIAzol Lysis Reagent (Qiagen) using 1.3 mm Chrome-Steel Beads (BioSpec ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction was stopped by heating at 65 °C for 20 min and products purified using a DyEx spin column (Qiagen). Reverse transcription was performed by mixing purified RNA with RT-primer (2 pmol/ μl ...
-
bioRxiv - Biophysics 2024Quote: ... to a density of 2 to 3 million cells /ml and then transfected with the MP-20 containing plasmid purified using a plasmid purification Giga kit (Qiagen). PEI MAX 40k (Polysciences ...
-
bioRxiv - Immunology 2024Quote: ... and homogenized via sonication at 20 kHz for 1 min before RNA isolation was performed using a RNeasy Mini Kit (Qiagen). For qPCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were diluted in TE buffer and treated with 1 μL of 20 mg/mL RNAse A (Applichem) for 1 h and 3 μL of Proteinase K (Qiagen) for 2 h at 40C ...
-
bioRxiv - Molecular Biology 2024Quote: ... was reverse transcribed at 37 °C for 2 h in a 20 μL reaction volume containing 4 U of Omniscript reverse transcriptase (Qiagen), 0.5 mM each dNTP ...
-
bioRxiv - Immunology 2024Quote: ... RNA extractions were performed on 10 mg (bladder) or 20 mg (decidua, placenta) by RNeasy Plus Mini Kit (Qiagen 74134). RNA sequencing was then performed by Novogene ...
-
bioRxiv - Genomics 2024Quote: ... were pooled together equimolarly and the final product was purified from a 2% agarose gel with 20 μl silica beads (QIAEX II Gel Extraction Kit, Qiagen). The three random libraries were purified individually ...
-
bioRxiv - Plant Biology 2024Quote: ... using a cryostat at -20°C (tangential cryosectioning approach22) to obtain the tissue for total RNA isolation with RNeasy Mini Kit (QIAGEN). For RNA extraction ...
-
bioRxiv - Cancer Biology 2024Quote: Cells were transfected with 20 nM siRNA (siTFE3 #sc-38507, siMITF (QIAGEN, custom siRNA sequence: AAAGCAGUACCUUUCUACCAC or siCTRL (QIAGEN # 1027281)) ...
-
Plasma Exosomes in Insulin Resistant Obesity Exacerbate Progression of Triple Negative Breast CancerbioRxiv - Cancer Biology 2024Quote: ... 1 μg of RNA was used to prepare 20 μL of cDNA using the QuantiTect Reverse Transcription Kit (Qiagen, 205313). The Mouse RT2 Profiler™ PCR Array for Epithelial to Mesenchymal Transition (EMT ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... for 20 min at 37 °C (2 units per sample) was followed by purification using the RNeasy minElute Cleanup kit (Qiagen). RNA quality of all samples was checked using the Agilent 2100 Bioanalyzer with an Agilent RNA 6000 Nano Kit ...
-
bioRxiv - Genetics 2024Quote: ... 20 µM of Illumina primers and 1:2000 dilution of 2 ng/µl library on Rotor-Gene Q machines (Qiagen), program and primer sequences are in Table) ...
-
bioRxiv - Plant Biology 2020Quote: ... Colonies growing on the selective medium containing the antibiotic gentamycin (20 µg/ml) were checked by colony PCR and the plasmid DNA extracted using the QIAprep® Spin Miniprep kit (Qiagen). A restriction reaction was performed on the extracted plasmid DNA and the positive samples were sequenced ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total DNA was extracted from muscles of each of the 20 individuals using a DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany). Field collections were conducted with permission from the Ministry of Research ...
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA (gDNA) was extracted from snap-frozen tissues (∼10–20 mg) using DNeasy Blood and Tissue Kit (Qiagen, Cat# 69504) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from batches of embryos, ICM or TE (n = 20) using PicoPur Arcturus (Excilone, France) with a DNase I (Qiagen, Germany) treatment as recommended by the supplier ...
-
bioRxiv - Genomics 2022Quote: ... equal volumes of the clones were combined together and the pool expanded in 20 mL of LB with 100 μg/mL carbenicillin for 9 hr followed by plasmid purification (Qiagen, 12943). Approximately 250 colonies in total were harvested.
-
bioRxiv - Evolutionary Biology 2021Quote: We homogenized tongue or ear tissue (stored at −20°C) and extracted genomic DNA using QIAamp Fast Tissue kits (Qiagen, Inc), with verification via gel electrophoresis (2% agarose) ...
-
bioRxiv - Molecular Biology 2021Quote: ... EGF (final concentration 20 ng/ml) was added for indicated times and RNA was extracted using an RNeasy plus kit (Qiagen, 74134) with DNase treatment according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2020Quote: ... in lysis buffer (180 μl buffer ATL with 20 μl proteinase K) provided in the DNeasy spin column kit (Qiagen, UK) using a Roche Magnalyser instrument and homogenization tubes containing ceramic beads (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... normal tissue or n=30 embryos at 20 hours post fertilization was used as input to the RT2 HT First Strand Kit (Qiagen #330411) to reverse transcribe cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... The qRT-PCR was performed using 20 miRNA primers (Supplementary Table 1) and miScript SYBR Green PCR Kit (Qiagen, Hilden, Germany). RNA U6 was used as the endogenous control ...
-
bioRxiv - Neuroscience 2022Quote: ... and the reminder 45 nt sequences were aligned to the GRCh38 Mus-Musculus reference genome (Ensembl rel. 97) using the CLC Genomics Workbench (CLC Bio) (v.20, QIAGEN Bioinformatics). An eight-nucleotide UMI tag and mapping coordinates were used to remove PCR-duplicate reads ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was extracted from liquid nitrogen-frozen cell pellets from 20 mL cultures grown to early stationary phase using the RNeasy Plant Mini Kit (Qiagen, Germany). Immediately after extraction ...
-
bioRxiv - Genomics 2022Quote: ... The resulting pellet was gently resuspended in 20 ml of pre-warmed (37°C) G2 lysis buffer (Qiagen; Cat. no. 1014636), incubated with 50 μg/ml RNaseA (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... diluted 2-times and 1 μl was taken for each PCR reaction (20 ul) containing: 0.02 U HotStarTaq® DNA polymerase (Qiagen, Germany), 1 x PCR buffer ...
-
bioRxiv - Microbiology 2020Quote: ... total DNA from the sample (20 g) was extracted using the Qiagen DNeasy® PowerSoil® Pro Kit (Qiagen, Hilden, Germany) and the integrity of DNA was evaluated by gel electrophoresis ...
-
bioRxiv - Physiology 2021Quote: Approximately 100 ng/µL of total DNA was extracted from 20 mg tissue (QiAMP DNA mini kit Qiagen, Valencia, CA, USA). DNA from bone marrow was extracted from the bone marrow suspension and centrifuged for 10 min at 2000 g ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 10-20 mg of silica-dried stem or leaf tissue was ground with a Qiagen TissueLyser II (Qiagen, Melbourne, Vic., Australia). DNA was extracted using the DNeasy 96 Plant Kit or DNeasyPlant Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: Genomic DNA was isolated from BMBMCs from 20 active ITP patients using a QIAamp DNA Blood Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 30 μl of 20 μM siRNA were mixed with 30 μl of HiPerFect transfection reagent (Qiagen, Cat. No: 301704, Courtaboeuf, France) or Promofectine siRNA transfection reagent (PromoKine ...
-
bioRxiv - Physiology 2020Quote: ... in lysis buffer (180 µl buffer ATL with 20 µl proteinase K) provided in the DNeasy spin column kit (Qiagen, UK) using a Roche Magnalyser instrument and homogenization tubes containing ceramic beads (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genotyping cell lines and mouse tissue was performed as above with 20 ng of genomic DNA isolated with a Qiagen DNeasy Blood and Tissue DNA Extraction Kit (Qiagen, #69504). All genotyping PCR reactions were performed using 0.4 U (0.08 μl ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The right pectoral fin was removed and stored in 95% ethanol at −20 °C prior to subsequent DNA extraction using QIAamp Fast DNA Tissue kits (Qiagen, Inc.) following the manufacturer’s protocols.
-
bioRxiv - Genomics 2022Quote: ... We extracted genomic DNA with standard CTAB method and purified it with QIAGEN Genomic-tip 20/g (Qiagen KK, Tokyo, Japan).
-
bioRxiv - Molecular Biology 2023Quote: Isolated RNA samples were reverse-transcribed into cDNA in 20 μl final reaction volumes using miScript II RT Kit(Qiagen,,Germany) as specified in the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Single contigs were obtained for all six genomes by de novo assembly using the CLC Genomics Workbench version 20 (QIAGEN Bioinformatics) with default settings ...