Labshake search
Citations for Eurogentec :
101 - 125 of 125 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: qPCR on 100-fold diluted samples was performed using the Takyon ROX SYBR Mastermix blue dTTP kit (Eurogentec) and the StepOnePlus real time PCR system (Applied Biosystem) ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNAs were used with 0.1µM of each primer (forward and reverse) and 2X MESA Blue qPCR mix (Eurogentec) in a 20µl final qPCR reaction ...
-
bioRxiv - Microbiology 2024Quote: ... with a reaction volume of 15 µL containing 7.5 µL of Takyon Master Mix (Eurogentec, Liège, BE), 1 µM of each primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR reactions were assembled according to the Takyon No ROX SYBR 2x MasterMix blue dTTP (Eurogentec, #UF-NSMT-B0701) qPCR kit ...
-
bioRxiv - Immunology 2023Quote: ... 200 ng of total cellular RNA was subjected to cDNA preparation followed by qPCR by the SYBR Green (Eurogentec) method ...
-
bioRxiv - Microbiology 2019Quote: ... IS2404 and KR-AB were then tentatively amplified by real-time PCR using RT-PCR reagents (Takyon, Eurogentec, Liège, Belgium) and primers and probes as previously described (8).
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). For real time based quantification to study comparative differential expression here are list of primers that has been used ...
-
bioRxiv - Genomics 2019Quote: ... All quantitative PCR assays were performed in duplicate with Mesa green qPCR 2x MasterMix Plus (Eurogentec 05-SY2X-06+WOU) on a CFX96 PCR system (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative PCR was then performed using an ABI7500 Fast instrument and the MESA Green qPCR MasterMix Plus for SYBR assay (Eurogentec). Relative expression was calculated via the Pfaffl method79 using Gapdh and Polr2a as references gene ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was diluted 1:5 in water and μl used as template for qPCR using Mesa blue MasterMix Plus for SYBR (Eurogentec) and a CFXConnect Real-Time System (BioRad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). 18s rRNA has been used as endogenous control.
-
bioRxiv - Microbiology 2021Quote: ... DNA eluted into 100 μl sample volume was tested in quantitative-PCRs (qPCRs) using primers and probes (Eurogentec, Seraing, Belgium) targeting sequences within metA ...
-
bioRxiv - Genetics 2019Quote: ... qRT-PCR experiments were performed with three independent biological replicates and two technical replicates each (if not stated otherwise) using the MESA Green qPCR Mastermix Plus (Eurogentec). qRT-PCR was performed using the CFX Connect Real-Time PCR Detection System and analyzed with the CFX Manager Maestro Software (BioRad).
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). Primers for viral genes are shown in Table 1 ...
-
bioRxiv - Plant Biology 2023Quote: Each quantitative PCR reaction was performed in three technical replicates with Takyon™ SYBR® 2X qPCR Mastermix Blue (Eurogentec) in 384-wells plates with a total volume of 10 uL using Light Cycler 480 apparatus (Roche) ...
-
bioRxiv - Pathology 2024Quote: ... All reactions were performed in Biorad® 96-well plates with the reagent kit for TaqMan® qPCR assays (Eurogentec), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Developmental Biology 2024Quote: ... qRT-PCR was performed using Takyon Rox SYBR 2x Master mix blue dTTP kit (Eurogentec Cat# UF-RSMT-B0701), with starting concentrations of template of around 10ng/µl and primer concentrations of 0.5µM ...
-
bioRxiv - Pathology 2023Quote: ... The qPCR on sylC was also performed in a final volume of 20 µL containing 10 µL of MasterMix buffer (Eurogentec, Belgium), 900 nM of each primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed in triplicates on cDNA (1:10 dilution) using Takyon™ No ROX SYBR 2X MasterMix blue dTTP (Eurogentec) and CFX Connect Real-Time System (Biorad) ...
-
bioRxiv - Microbiology 2022Quote: ... A region of 168 base pairs on the PB2 protein was amplified by RT-PCR using custom primers (Table S6)(Eurogentec, Maastricht, Netherlands) and the QIAGEN OneStep RT-PCR Kit (Qiagen ...
-
bioRxiv - Bioengineering 2022Quote: ... 3.75 μL of the appropriately diluted samples (ranging from 4 to 12.5-fold) were mixed with 7.5 μL of qPCR mastermix (MasterMix Plus for SYBR© Green I with fluorescein, Eurogentec, Liège, Belgium) in a final volume of 15 μL ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was used for real-time PCR analysis using Takyon Low Rox Probe 2x Master Mix dTTP Blue (Eurogentec, Liège, Belgium) with TaqMan® Assay-on-demand kits (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... and mRNA expression assayed with a two-step real-time quantitative PCR assay with qPCR MasterMix Plus w/o UNG with SYBR® Green I No Rox (Eurogentec S.A, Seraing, Belgium) using a Lightcycler® 480 Instrument (Roche Applied Science ...
-
bioRxiv - Genomics 2021Quote: ... in a final volume of 10 µL (0.5 µL of each primer, 5 µL of Eurogentec Takyon™ SYBR® 2 x qPCR Mastermix Blue). The following Light-Cycler run protocol was used ...