Labshake search
Citations for Eurogentec :
1 - 50 of 125 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Master mixes of Takyon Master Mix for SYBR® Assay mix (Eurogentec): Water ...
-
bioRxiv - Cell Biology 2023Quote: ... CD79α and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was measured by RT-qPCR using Takyon SYBR Master Mix (Eurogentec), 100nM of specific primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... qPCR was performed with Mesa Green qPCR master mix (Eurogentec) with specific primers listed in (primers Supplementary Table 1) ...
-
bioRxiv - Physiology 2020Quote: ... qPCR was performed using MESA BLUE qPCR Master Mix (Eurogentec) on a Bio-Rad T100 thermocycler using gene-specific intron-flanking primers (Table 4) ...
-
bioRxiv - Molecular Biology 2019Quote: ... For RT-qPCR the MESA Blue qPCR MasterMix Plus kit was used (Eurogentec). For each gene MESA Blue was mixed with 100nM forward and reverse primers (refer to table 2.2) ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using the 2x MESA Green qPCR Master Mix Plus (Eurogentec) for SYBR assays in 50 µl reactions containing 32 ng cDNA at a primer concentration of 600 nM each ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... For qPCR MESA blue (Eurogentec, RT-SYS2X-03-+NRWOUB) was used ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR mix contained Takyon qPCR master mix (Eurogentec), 500 nM gene-specific primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-qPCR was carried out using Mesa Blue mastermix (Eurogentec). All reactions were normalised to Gapdh as a control.
-
bioRxiv - Immunology 2022Quote: ... were used in a one-step RT-qPCR using the Takyon-One Step RT probe mastermix (Eurogentec) and run on a Roche Light Cycler 96 ...
-
bioRxiv - Microbiology 2022Quote: ... were used in a one-step RT-qPCR using the Takyon-One Step RT probe mastermix (Eurogentec) and run on a Roche Light Cycler 96 ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-qPCR was performed using MESA Blue SYBR Green Mastermix (Eurogentec). Pre-designed primers were purchaced from OriGene Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative RT–PCR was performed using qPCR MasterMix Plus Low ROX (Eurogentec) and TaqMan Gene Expression Assays (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... Total volume of qPCR reaction was 20µl and it contained 10µl of 2x qPCR Master Mix Low ROX (Eurogentec), 1µl of 20x TaqMan Gene Expression Assay (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Total volume of qPCR reaction was 20µl and it contained 10µl of 2x qPCR Master Mix Low ROX (Eurogentec), 1µl of 20x TaqMan Copy Number Assay (Life Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... All RT-qPCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). GLuc was amplified using GLuc forward primer CCTACGAAGGCGACAAAGAG and reverse primer TTGTGCAGTCCACACACAGA and results were normalised by amplifying 18s primer sequences ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR experiments were performed using TakyonTM Low ROX SYBR MasterMix (Eurogentec, Belgium) with the AriaMx Real-Time PCR system (Agilent Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... which also contained 10 µl of the Power SYBR green PCR master mix of qPCR master mix plus for SYBR Green I (Eurogentec, Seraing ...
-
Ion transport modulators differentially modulate inflammatory responses in THP-1 derived macrophagesbioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed using the Mesa green qPCR master mix (Eurogentec, Seraing, Germany). All primer sequences were obtained from Primerbank (Table 2) ...
-
bioRxiv - Immunology 2024Quote: ... followed by qPCR using the Takyon Low Rox Probe Master mix dTTP Blue (Eurogentec) and primers/probe pre-designed assays (Integrated DNA Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RT-qPCR amplification was carried out with the dsDNA-specific dye Takyon™ SYBR® 2X qPCR Mastermix Blue (Eurogentec Cat#UF-FSMT-B0701) and monitored in real-time with a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Plant Biology 2020Quote: ... Reverse transcription quantitative PCR (RT-qPCR) was carried out with Takyon No ROX SYBR mastermix (Eurogentec, Belgium) as in Atkinson et al.17 ...
-
bioRxiv - Physiology 2023Quote: ... Messenger RNA (mRNA) expression levels were assessed by quantitative polymerase chain reaction (RT-qPCR) using Takyon SYBR green (Eurogentec) (primers indicated in supplemental table 1 ...
-
bioRxiv - Microbiology 2019Quote: ... Each 20 µL reaction mixture consisted of 10 µL of MESA Blue qPCR Master Mix (Eurogentec, Seraing, Belgium), 300 nM primers (600 nM for mcrA genes) ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR amplification was performed using MESA Green qPCR MasterMix for SYBR assay (Cat. No. RT-SY2X-03+WOUN, Eurogentec, Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... RT-qPCR was performed on the Stratagene 500 MX3005P using a SYBR Green reaction mix (Eurogentec, Cat#10-SN2X-03T). The primers used for mRNA detection of target genes by RT-qPCR are listed in Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... one-step qPCR assay was performed using 5 μL of RNA and Takyon Low rox one-step RT probe Mastermix (Eurogentec) and specific primers and probe targeting E gene ...
-
bioRxiv - Developmental Biology 2021Quote: ... qPCR was performed using 7.5 µl of Takyon Rox SYBR Master mix blue dTTP kit (Eurogentec, UF-RSMT-B0701), 1.5 µl of cDNA and 0.5 µl of each 5µM primers (see Table 3) ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative (q) real time PCR (q-RT PCR) was performed with the MESA Green qPCR MasterMix Plus for SYBR Assay® (Eurogentec) using the Applied Biosystems™ StepOnePlus™ Real-Time PCR System ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-qPCR experiments were performed with 4µL of cDNA combined to the Takyon No Rox SYBR MasterMix (Eurogentec, UF-NSMT-B0701), using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Physiology 2019Quote: ... and each sample was run in triplicate with 2 µL of the diluted cDNA and 8 µL of master mix containing 1x qPCR MasterMix Plus Low ROX (Eurogentec, Liège, Belgium) or 1x TaqMan gene expression MasterMix (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... For qPCR a SYBR Green core qPCR kit (Eurogentec) and a StepOnePlus machine (ThermoFisher ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR (qPCR) was performed on the synthesised cDNA using Takyon™ Low ROX SYBR®master mix ddTTP blue (Eurogentec Liège, Belgium). qPCR was performed in three technical replicates and a non-template control was included ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time qPCR was performed using qPCR Mastermix Plus – Low ROX (Eurogentec) on a ViiA 7 thermocycler (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time PCR (qPCR) using a SYBR Green core qPCR kit (Eurogentec) and an ABI Prism 7000 machine (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... qPCR was performed using MESA GREEN qPCR MasterMix Plus for SYBR® (Eurogentec, UK) and an ABI 7900HT Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... Mesa Green qPCR MasterMix (Eurogentec) was added to the cDNA (5 μl for every 2 μl of cDNA) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µL of master mix (2X Takyon ROX SYBR master mix, Eurogentec, Belgium) and nuclease-free water to a final volume of 20 µL ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed using MESA BLUE qPCR 2X MasterMix Plus for SYBR® Assay (Eurogentec) using a 2-step reaction protocol for 40 cycles and each sample was processed in technical triplicates ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed using MESA BLUE qPCR 2X MasterMix Plus for SYBR® Assay (Eurogentec) using a 2-step reaction protocol for 40cycles with systematic evaluation of primer melting curve ...
-
bioRxiv - Microbiology 2022Quote: ... 6.25 µl master mix (Eurogentec), 0.375 µl of forward primer ...
-
bioRxiv - Immunology 2023Quote: ... using a master mix (Eurogentec), with the following Taqman Assays primers (Merck) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative polymerase chain reaction (qPCR) was performed with the MESA BLUE qPCR kit for SYBR assay (Eurogentec) on a LightCycler96 system (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... All quantitative polymerase chain reactions (qPCRs) were assembled using the MESA BLUE qPCR kit for SYBR assay (Eurogentec) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Gene expression was measured by qPCR using MESA BLUE qPCR MasterMix Plus for SYBR® Assay No ROX (Eurogentec) and cycle quantification by Biorad CFX system.
-
bioRxiv - Molecular Biology 2019Quote: ... 10 µl of Master Mix Roche (Eurogentec). The concentration of each primer per reaction was 0.5 µl for simplex qPCR and 0.75 µl for both duplex and triplex ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6.25 µL of master mix (Eurogentec, Belgium), 0.375 µL of each forward and reverse primer (to a final concentration for each primer ...
-
bioRxiv - Cell Biology 2023Quote: ... Takyon ROX SYBR Master Mix blue (Eurogentec) was used with a 0.4 µM final primer concentration (Supplementary Table S1) ...