Labshake search
Citations for Eurogentec :
51 - 100 of 733 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... using the Takyon No Rox SYBR MasterMix dTTP Blue (Eurogentec) in 384-well plates according to the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... Guinea pig anti-TPI-GAPDH (1:1000; Eurogentec), previously shown to localise in the mitochondria (Bártulos et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-HMGI-C (Eurogentec), rabbit anti-human HMGA2 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2024Quote: ... The qPCR was performed using Takyon Low ROX SYBR 2X MasterMix (Catalog No. UF-LSMT-B0701, Eurogentec) and KiCqStart pre-designed SYBR green gene-specific primers (Supplementary Table S4 ...
-
bioRxiv - Cell Biology 2024Quote: ... complementary DNA were diluted 1/20 for quantitative PCR (qPCR) reactions using Mesa green qPCR Master Mix (Eurogentec, Angers, France). PCR was conducted using the Mx 3000P real-time PCR system (Stratagene ...
-
bioRxiv - Biochemistry 2024Quote: ... All oligonucleotides containing modified bases and their complementary strands were purchased from Eurogentec (Seraing, Belgium). The oligonucleotides were 5’-end labelled with [γ-32P]-ATP (PerkinElmer ...
-
bioRxiv - Cancer Biology 2024Quote: ... ANGPT1 and ANGPT2 and scrambled siRNA as a negative control (Eurogentec) for 48 hrs in low serum media using INTERFERin kit (Cat# 409-10 ...
-
bioRxiv - Microbiology 2024Quote: ... Primary antibodies were raised in rabbits against synthetic peptides of Hcp (Eurogentec) and used at a dilution of 1:667 in 2.5% skim milk ...
-
bioRxiv - Microbiology 2024Quote: ... using the Takyon Low Rox SYBR kit (Eurogentec, Seraing, Belgium). Data were analyzed by the 2-ΔΔCT method using HPRT and GAPDH (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... and the Takyon ROX Probe Mastermix kit (Eurogentec, Seraing, Belgium). Broth samples with positive PCR were plated on SCAI media after serial dilution (10-4 ...
-
bioRxiv - Microbiology 2024Quote: siRNA smartpools were purchased from Dharmacon (Lafayette, USA) except for siRNAs for ISG15 which were individually purchased from Eurogentec (Seraing, Belgium). One and half microliter siRNA (10 μM ...
-
bioRxiv - Microbiology 2024Quote: ... Competence was induced with 1μL of CSP 2 (Eurogentec) and then incubated at 5% CO2 and 37°C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Quantification was performed using a SYBR assay using the Takyon SYBR Blue MasterMix (Eurogentec, Seraing, Belgium) with primer pairs (Table 2) ...
-
bioRxiv - Microbiology 2024Quote: Polyclonal antibodies against the male gametocyte marker LDH2 (PF3D7_1325200) and the female gametocyte marker PfG377 (PF3D7_1250100) were commercially raised in rats and guinea pigs respectively by Eurogentec using the 2 peptide 28-Day Speedy programme ...
-
bioRxiv - Immunology 2024Quote: ... using dTTP MasterMix (Eurogentec), according to the manufacturer ’s instructions (for each well ...
-
bioRxiv - Immunology 2024Quote: ... and primers (Forward Primer: CGGTCCAAATTCCTGCTGA; Reverse primer: CATTGGGTTCCTTCCATCCA) were from Eurogentec. Concentrated TaqMan assays (20× ...
-
bioRxiv - Microbiology 2024Quote: ... 6His-VIBHAR_05027 and 6His-VIBHAR_01983 were detected by incubating the membrane in TBST with primary polyclonal antibodies (Kaneka Eurogentec, Seraing, Belgium) or primary monoclonal antibodies against the 6His-tag (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Takyon™ SYBER MasterMix blue dTTP (Eurogentec, ref UF-NSMT-B0701) and 1 µL at 500 nM of each primers for OsHV-1 µVar (OsHVDPFor5’-ATTGATGATGTGGATAATCTGTG and OsHVDPFor 5’-GGTAAATACCATTGGTCTTGTTCC ...
-
bioRxiv - Systems Biology 2024Quote: ... Peptide antibodies were synthetised and purified by Eurogentec (anti-peptide programme AS-DOUB-LXPGUI). Anti-PDF (PDF C7) ...
-
bioRxiv - Physiology 2024Quote: ... or with control oligonucleotides (5′ UUC-UCC-GAA-CGU-GGC-ACG-AdTdT 3′ and 5′ UCG-UGC-CAC-GUU-CGG-AGA-AdTdT 3′; Eurogentec, Seraing, Belgium). When endothelial cells reached 80% confluency ...
-
bioRxiv - Immunology 2024Quote: ... RT-PCR was performed using the SYBR Green PCR kit (Eurogentec, Germany) and data were acquired with the ABI prism 7300 RT-PCR system (Applied Biosystems / Life Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... The universal siRNA negative control was purchased from Eurogentec.
-
bioRxiv - Developmental Biology 2024Quote: ... Four siRNAs corresponding to different regions of the Gallus gallus GLS mRNA were designed using the sidirect2.rnai.jp website and purchased from Eurogentec: siRNA.1 GLS ...
-
bioRxiv - Physiology 2024Quote: ... directed against ADAR1 (5′ GCU-AUU-UGC-UGU-CGU-GUC-AdTdT 3′ and 5′ UGA-CAC-GAC-AGC-AAA-UAG-CdTdT 3′; Eurogentec, Seraing, Belgium), or with control oligonucleotides (5′ UUC-UCC-GAA-CGU-GGC-ACG-AdTdT 3′ and 5′ UCG-UGC-CAC-GUU-CGG-AGA-AdTdT 3′ ...
-
bioRxiv - Plant Biology 2024Quote: ... in a final volume of 10 µL SYBR Green Master mix (Eurogentec). AT4G26410 (RGS1-HXK1 INTERACTING PROTEIN 1 ...
-
bioRxiv - Physiology 2024Quote: ... Quantitative PCR was performed with Takyon NO ROX SYBR Mastermix blue dTTP (Eurogentec, UF-NSMT-B0701) using a Bio-Rad CFX96 apparatus ...
-
bioRxiv - Plant Biology 2024Quote: ... Antibodies were purchased from Eurogentec (Liège ...
-
bioRxiv - Pathology 2024Quote: ... qPCR reaction was performed in duplicate using Takyon ROX SYBR MasterMix blue dTTP (Eurogentec) on an Applied Biosystems QuantStudio 5 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... anti-5mC (1:500; Eurogentec; BI-MECY-100). After washing out the primary antibodies in PBS-T ...
-
bioRxiv - Microbiology 2024Quote: ... One-step qPCR assay was performed using 5 µL of RNA and Takyon Low rox one-step RT probe master mix (UFD-LPRT-C0101, Eurogentec) with specific primers and probes (Supplemental Table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... The Takyon™ No ROX Probe 2X MasterMix Blue dTTP (Eurogentec, Belgium) was used with a final reaction volume of 20 µL containing 10 µL of Master Mix 2X (final concentration 1X) ...
-
bioRxiv - Microbiology 2024Quote: ... using Takyon 2X MasterMix (Eurogentec) in triplicate ...
-
bioRxiv - Plant Biology 2024Quote: ... in 10 µl mixtures each containing 5 µl of Takyon™ ROX SYBR® MasterMix dTTP Blue (Eurogentec, UF-RSMT-B0710 ...
-
bioRxiv - Developmental Biology 2024Quote: ... we used the sensolyte-mug-beta-galactosidase-assay-kit-fluorimetric (Cat #, AS-72132; Eurogentec, Seraing, Belgium). Fluorescence signal was recorded on Promega GloMax Explorer (Cat # ...
-
bioRxiv - Plant Biology 2024Quote: ... melting curve analysis) with the Takyon no ROX SYBR 2X master mix (Eurogentec).
-
bioRxiv - Cancer Biology 2024Quote: ... qPCR reactions were conducted in triplicate for each sample using Takyon Low ROX SYBR 2X MasterMix blue dTTP (Eurogentec, Cat. No. UF-LSMT-B0701) and KiCqStart® SYBR® Green pre-designed primers (Table 3 ...
-
bioRxiv - Biophysics 2024Quote: The annealed product was purchased from Eurogentec. The gap DNA substrate for reconstitution of LTAg and ATP apo complex was created by annealing oligonucleotides 5’-AGCTATGACCATGATTACGAATTG[23ddC]-3’ and 5’-TTTTTCGGAGTCGTTTCGACTCCGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCAATTCGTAATCATGGTCATAGCT-3’ ...
-
bioRxiv - Immunology 2024Quote: ... The expression of the genes HIF-1α and LDH-A was determined using the PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 1.5 µL of PCR products (1/10 diluted for whole individual samples) were pooled with 0.25 μL of RadiantDyTM 632 500 MOB size standard (Eurogentec, Seraing, Belgium) and 9.75 μL of formamide (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... The synthetized PCR primers (Eurogentec) were used to generate SNAT-2 ...
-
bioRxiv - Developmental Biology 2024Quote: Except for 5’ peroxidase-conjugated secondary probes for TSA SABER FISH (Eurogentec) and HCR amplifiers for SABER-HCR FISH (Molecular Instruments) ...
-
bioRxiv - Molecular Biology 2024Quote: All oligonucleotides were purified by polyacrylamide gel electrophoresis and purchased from Eurogentec. The labeling of oligonucleotides at the 5’-end was carried out by T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... and bOGC (Eurogentec) were diluted with 3% BSA in PBS with 0.01% Triton X-100 at 1:5000 ...
-
bioRxiv - Cell Biology 2024Quote: ... conjugated to cyanine 5 in 5’ (Eurogentec, Belgium) has been described elsewhere (Cruz Da Silva et al. ...
-
bioRxiv - Immunology 2024Quote: ... Cxcl3 reverse: 5’-CCTTGGGGGTTGAGGCAAACTT-3’ (Eurogentec) for the quantification of Cxcl1 ...
-
bioRxiv - Cancer Biology 2024Quote: SiRNA were designed using siRNA design websites (https://rnaidesigner.thermofisher.com/rnaiexpress/) and (https://eurofinsgenomics.eu/en/ecom/tools/sirna-design/) and were synthesized by Eurogentec (Extended Data Table 4). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dead cells were excluded using 7-Aminoactinomycin D (7-AAD, Eurogentec), or 4,6-Diamidine-2-phenylindole dihydrochloride (DAPI ...
-
bioRxiv - Plant Biology 2024Quote: ... qPCR was performed using MESA BLUE qPCR 2X MasterMix Plus for SYBR® Assay (Eurogentec) in technical triplicates ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-ALBA4 antibodies were affinity-purified by Eurogentec from serum collected from rabbits immunized with recombinant ALBA1 protein or a 1:1 mix of the KLH- coupled ALBA4 peptides H-CGFNNRSDGPPVQAAA-OH and H- CNGPPNEYDAPQDGGY-NH2 (Eurogentech) ...
-
bioRxiv - Microbiology 2024Quote: ... 6.2511μL master mix (Eurogentec), 0.37511μL of forward primer (511-CCGCTGCCCAACACAAG-311 ...