Labshake search
Citations for Eurogentec :
1 - 50 of 730 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Reactions were carried out in a 20 µL reaction mix containing 10 µL of Takyon ROX Probe MasterMix Blue dTTP (Eurogentec) at a final concentration of 1X ...
-
bioRxiv - Genomics 2024Quote: ... filiformis ParB antibody (Eurogentec) with a 1:1000 dilution ...
-
bioRxiv - Genomics 2024Quote: ... oneisti ParB antibody (Eurogentec). All primary antibodies were incubated in blocking solution overnight at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... followed by qPCR using the Takyon Low Rox Probe Master mix dTTP Blue (Eurogentec) and primers/probe pre-designed assays (Integrated DNA Technologies) ...
-
bioRxiv - Microbiology 2024Quote: SDS-PAGE were run on iD PAGE gel 10% (Eurogentec) with MOPS buffer and bands detected with Coomassie blue staining ...
-
bioRxiv - Microbiology 2024Quote: ... and 5-FAM-LC-LL37 (Eurogentec) solution (14 µM ...
-
bioRxiv - Microbiology 2024Quote: ... The Takyon™ No ROX Probe 2X MasterMix Blue dTTP (Eurogentec, Belgium) was used with a final reaction volume of 20 µL containing 10 µL of Master Mix 2X (final concentration 1X) ...
-
bioRxiv - Microbiology 2024Quote: ... the serum was yielded (Eurogentec).
-
bioRxiv - Cell Biology 2024Quote: ... comprising 5 μL of TakyonTM MasterMix (Eurogentec), 0.5 μL of TaqMan® gene expression assay probes (Table 1) ...
-
bioRxiv - Physiology 2024Quote: ... and reverse transcribed with the Reverse Transcriptase Core kit (Eurogentec). Gene expression was analyzed by quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Plant Biology 2024Quote: ... following the manufacturer’s instructions (Eurogentec). Amplification was performed with 1 µL of a 1:10 or 1:20 dilution of cDNA in a total volume of 10 µL ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR experiments were performed using TakyonTM Low ROX SYBR MasterMix (Eurogentec, Belgium) with the AriaMx Real-Time PCR system (Agilent Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... capture and detection antibody was the same affinity-purified custom anti-(GP)8 antibody (Eurogentec, biotinylated for detector). For polyGA ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... For qPCR MESA blue (Eurogentec, RT-SYS2X-03-+NRWOUB) was used ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR was performed on a Applied Biosystems™ QuantStudio™ 5 Real-Time PCR System with SYBR Green PCR MasterMix (Eurogentec). Each reaction was performed on a 1:20 dilution of the cDNA ...
-
bioRxiv - Plant Biology 2024Quote: ... using Takyon™ reagents (Eurogentec, Liège, Belgium). MasterMix ...
-
bioRxiv - Pathology 2024Quote: ... The optimal primer concentration was 300 nM with MESA Green qPCRTM Mastermix Plus for SYBR® Assays (Eurogentec) and 100 nM for TaqMan® probes ...
-
bioRxiv - Pathology 2024Quote: ... All reactions were performed in Biorad® 96-well plates with the reagent kit for TaqMan® qPCR assays (Eurogentec), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the diluted cDNA was used together with Takyon No Rox SYBR MasterMix dTTP Blue (Eurogentec, Seraing, Belgium). AT3G01150 was chosen as reference gene (Czechowski et al. ...
-
bioRxiv - Cell Biology 2024Quote: Anti-TbMyo1 antibodies were generated by immunisation of two rabbits with purified recombinant TbMyo1 (amino acids 729–1,168) (Eurogentec). For recombinant protein expression the TbMyo1 tail was cloned into a pET-28a(+ ...
-
bioRxiv - Cell Biology 2024Quote: ... Control cells were electroporated with a scramble siRNA (siRNA-negative control duplex; Eurogentec).
-
bioRxiv - Cell Biology 2024Quote: ... The RNAi target fragments were amplified by PCR from synthesised copies of TbMYO1 and TbMYO21 in a pUC57 plasmid (Eurogentec). The fragments were ligated into Eam1105I-cut p2T7_TAblue using in vivo assembly (IVA ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative real-time PCR was performed at 60°C using Takyon No ROX SYBR 2X MasterMix blue dTTP (Eurogentec) in the LightCycler 480 (Roche ...
-
bioRxiv - Physiology 2024Quote: Transcript expression was assessed using low ROX Takyon (Eurogentec) on 1:25 diluted cDNA with the CFX96 real-time system (BIORAD ...
-
bioRxiv - Microbiology 2024Quote: ... with a reaction volume of 15 µL containing 7.5 µL of Takyon Master Mix (Eurogentec, Liège, BE), 1 µM of each primer ...
-
bioRxiv - Molecular Biology 2024Quote: LNA/DNA mixmers were purchased from Eurogentec S.A ...
-
bioRxiv - Microbiology 2024Quote: ... Antimicrobial peptides were purchased from Eurogentec. Antibiotic MIC strips were obtained from Liofilchem.
-
bioRxiv - Molecular Biology 2024Quote: All the model oligonucleotides were purchased from Eurogentec (Seraing, Belgium) and Biomers.net GmbH (Ulm ...
-
bioRxiv - Microbiology 2024Quote: ... All RT-qPCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). GLuc was amplified using GLuc forward primer CCTACGAAGGCGACAAAGAG and reverse primer TTGTGCAGTCCACACACAGA and results were normalised by amplifying 18s primer sequences ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 30-bp complementary DNA fragments corresponding to the marRAB or acrAB marboxes with 5 nucleotides in each flank were purchased from Eurogentec (Seraing ...
-
bioRxiv - Molecular Biology 2024Quote: ... hepatica cathepsin L3 (rFhCL3; Eurogentec) as a non-related control ...
-
bioRxiv - Molecular Biology 2024Quote: ... hepatica cathepsin L1 pro-peptide (rFhCL1pp; 1:500 dilution, non-related control) and pre-immune anti-rFhCL1pp (1:500 dilution) (Eurogentec). Parasite sections were incubated at RT for five hours in a humid container ...
-
bioRxiv - Immunology 2024Quote: ... using MESA GREEN qPCR Mastermix Plus for SYBR Assay (Eurogentec). Actb (β-Actin ...
-
bioRxiv - Microbiology 2024Quote: ... Primers were ordered from Eurogentec. All plasmids were sequenced using a 3130XL or 3500XL Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: Oligonucleotides were purchased from Eurogentec (Belgium) and used without further purification ...
-
bioRxiv - Cell Biology 2024Quote: ... SYBR Green method (Eurogentec, Liège, Belgium) and specifically designed primers (Eurogentec ...
-
bioRxiv - Microbiology 2024Quote: Labeled and unlabeled oligonucleotides were purchased from Eurogentec and Eurofins Genomics respectively.
-
bioRxiv - Microbiology 2024Quote: ... The PCR mix consisted of 1X Goldstar™ DNA polymerase (Eurogentec, Seraing, Belgium) and 400 nM of each primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... poly(GR) and poly(PR) were custom-generated (Eurogentec) and purified in-house using affinity membrane chromatography ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plates were washed again in TBS-T and 50 μl MSD® SULFO-TAG labelled streptavidin (1 μg ml-1) and biotinylated poly(GP) antibody (1 μg ml-1, Eurogentec) added per well diluted in blocking solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cyp1b1 or a negative control siRNA (Eurogentec, Belgium) were done using Lipofectamine RNAiMAX reagent (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: A poly(GP) Meso Scale Discovery (MSD®) enzyme-linked immunosorbent assay (ELISA) was established using a custom made rabbit αLGP antibody (Eurogentec) and based on previously described methods16 ...
-
bioRxiv - Neuroscience 2024Quote: ... The following antibodies were used: anti-poly(GP) (GP658, custom-made from Eurogentec) and anti-poly(GA ...
-
bioRxiv - Neuroscience 2024Quote: ... SMI312 (Eurogentec, 1:500), synaptophysin 1 (SySy ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Female Rag2−/− mice infused with Marilyn T-ALL cells were treated intraperitoneally once a week for two weeks with 0.01 mg of DBY peptide (NAGFNSNRANSSRSS; cat. no. AS-61046; Eurogentec).
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Biochemistry 2024Quote: The expression and cellular localization of BT4244 M60L was determined using rabbit polyclonal antibodies (Eurogentec) generated against a purified recombinant version of the protein lacking the lipoprotein signal sequence ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions were analysed by Western blotting using a 1/10,000 dilution of primary rabbit anti-FLAG® antibodies (Eurogentec) followed by a 1/5000 dilution of secondary donkey anti-rabbit IgG conjugated to HRP (Santa Cruz biotechnology ...
-
bioRxiv - Cell Biology 2024Quote: ... and specifically designed primers (Eurogentec, Liège, Belgium; Millipore Sigma) listed in Table 1 were used ...