Labshake search
Citations for Mirus Bio :
101 - 150 of 338 citations for 6H Benzo g 1 4 diazonino 7 6 5 cd indol 6 one 10 ethenyl 1 3 4 5 7 8 10 11 12 13 decahydro 4 hydroxymethyl 8 10 13 trimethyl 7 13 bis 1 methylethyl 4S 4R* 7R* 10S* 13S* 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... constructs were packaged into lentivirus in a 10 cm plate 60% confluent of HEK293T cells using the TransIT-LT1 (Mirus Bio, MIR2300) transfection reagent and 7Lμg of the vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... before adding 6 µl of TransIT VirusGen transfection reagent (Mirus MIR6700). The transfection mixture was incubated for 10 to 15 min and then added dropwise to HEK293T cells ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were co-transfected with receptor of interest and TRUPATH plasmids at 1:1:1:1 DNA ratio (receptor:Gα-RLuc8:Gβ:Gγ-GFP2) via TransIT-2020 (Mirus Cat# MIR5400). Each condition required 97 µL of room-temperature 1x Opti-MEM (Gibco Cat# 31985070) ...
-
bioRxiv - Genomics 2022Quote: Transection was performed in a 10-cm dish at 70%-80% confluence with 30 ul of TransIT 2020 transfection reagent (Mirus Bio, MIR 5400A) and 10μg of total DNA (1µg of pMT-ROWx2FLAG and 9 µg of bluescript plasmids) ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were co-transfected with a lentiviral sgRNA expression plasmid and the packaging vectors pCMVΔ8.91 and pMD VSV-G (1:0.7:0.3 mix) using TransIT-293 (Mirus Bio). HEK293T media was collected 48 h post-transfection ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 µg PMD2.G packaging plasmids using 25 µL TransIT-LT1 Transfection Reagent (Mirus, MIR 2306). After 72 h of transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with either Fugene 6 or with TransIT-LT1 (Mirus). For knockdown experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6×105 cells were resuspended in 100 μL Ingenio Electroporation Solution (Mirus), and RNP complex with either 100 pmol ssODN or 7.5 μg plasmid donor DNA was added to the cell suspension ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 6-well plates by using TransIT-293 transfection reagent (Mirus #MIR2705) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and RdRp-N462 or RdRp-D462 were transfected into 293T cells at a 1:1:1 ratio using TransIT LT-1 (Mirus, Madison, WI). To normalize transfection efficiency ...
-
bioRxiv - Cell Biology 2021Quote: ... the renilla luciferase reporter at 0,4 ng/mL and miRNA mimics at 10 nM using TransIT-X2 (Mirus Bio, Madison, WI, USA, #MIR 6000) according to manufacturer’s instructions ...
-
bioRxiv - Pathology 2021Quote: ... Ad293 cells were cultured in 96 well plates with DMEM containing 10% FB Essence (Avantor Seradigm, USA) and transfected using Transit-LT1 (Mirus Bio, Madison, WI, USA) with plasmid encoding 4 LXR response elements fused with luciferase ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were grown in 6-well plates or 10-cm dishes and allowed to reach 50%-70% confluency before transient transfection using TransIT-2020 (Mirus Bio, catalog #: MIR 5400) according to the manufacturer’s instruction.
-
bioRxiv - Biochemistry 2021Quote: ... and 1 μg of PiggyBac transposase expression vector (total = 3 μg) using TransIT-LT1 (Mirus Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and a Venus-tagged N-terminal β-arrestin2 using 3:1 ratio of TransiT-2020 (Mirus). 5-HT2A receptor mutants were designed and performed using Q5 mutagenesis kit (New England Biolabs) ...
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... The VSV-G pseudotyped lentivirus was packaged by 5 plasmid co-transfection of HEK293T cells using TansIT Transfection Reagent (Mirus Bio) in 15 cm culture dishes (The protocol describing production of lentiviral particles can be found at http://www.www.bu.edu/dbin/stemcells/protocols) ...
-
bioRxiv - Microbiology 2023Quote: ... and 6 μl of TransIT-X2 Dynamic Delivery System (Mirus Bio; #MIR 6000). Following incubation at room temperature for 25 min ...
-
bioRxiv - Microbiology 2021Quote: ... 8×106 cells were suspended in 800 μl Ingenio® Electroporation Solution (Mirus Bio, Madison, WI) and mixed with 10 μg RNA in a 4-mm cuvette ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3:1 volume:mass ratio of Mirus TransIT®-LT1 transfection reagent (Mirus Bio LLC, Madison WI) to DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1 μg PMD2.G packaging plasmids using 25 μl TransIT®-LT1 Transfection Reagent (Cat# MIR 2306, Mirus). After 72 h of transfection ...
-
bioRxiv - Microbiology 2019Quote: ... and varying input (50 ng for 5-site screen and 15 ng for 4-site screen) of MxA plasmids were co-transfected into HEK 293T cells using the reagent TransIT-LT1 (Mirus Bio) in a 96-well plate format ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lentivirus expressing RIPK3 shRNA was generated by transfecting HEK-293T cells in 6 well plate with a 1: 0.1: 1 ratio of pMDG2: pVSVG: pLKO.1 with TransIT-LT1 transfection reagent (Mirus). After filtering through 0.45 μm of cellulose acetate membrane (VWR ...
-
bioRxiv - Biochemistry 2024Quote: ... and TRUPATH plasmids at 1:1:1 DNA ratio (Gα-RLuc8:Gβ:Gγ-GFP2) via TransIT-2020 (Mirus Cat# MIR5400). Each condition required 97 µL of room-temperature 1x Opti-MEM (Gibco Cat# 31985070) ...
-
bioRxiv - Cell Biology 2020Quote: ... pTRIPz or pLKO.1 plasmid was co-transfected with lentiviral Packaging vectors (pMD2.G and psPAX2) into HEK293T using TransIT-LT1 (Mirus) transfection reagent following the manufacturer instruction ...
-
bioRxiv - Microbiology 2024Quote: ... HIV-1 ΔENV pseudotyped with VSV-G were generated by transient transfection of HEK 293T cells using TransIT-LT1 (Mirus). For HIV-1 ΔENV ΔVpr with Vpr WT packaged in trans (HIV-1ΔVpr +Vpr WT) ...
-
bioRxiv - Biophysics 2021Quote: ... δ and ε subunits in the ratio 2:1:1:1 (TransIT® 293 transfection reagent; Mirus Bio, Madison, WI). Electrophysiological experiments started ~48 hours post-transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Microbiology 2020Quote: ... Monolayers of ∼ 8 × 105 BHK-T7 cells were co-transfected using TransIT-LT1 transfection reagent (Mirus Bio LLC) with 0.8 μg each of nine plasmid constructs representing the T1L reovirus genome plus a single parental or mutant pBacT7-S1 plasmid ...
-
bioRxiv - Genomics 2021Quote: ... and packaging plasmids for expression of HIV-1 gag/pol and rev (+/-tat) and VSV-G envelope protein using either TransIT®-LT1 Transfection Reagent (Mirus) or Polyethylenimine (Polysciences ...
-
bioRxiv - Biochemistry 2021Quote: ... and 1 μg of PiggyBac transposase expression vector (total = 3 μg) using TransIT-LT1 (Mirus Bio, Madison, WI, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µg of each sgRNA plasmid and 3 µg of dCas9-KRAB-MeCP2 plasmid were co-nucleofected into 1 × 106 mHypoA cells resuspended in a 1:1 mixture of Ingenio Electroporation reagent (Mirus Bio 50111) and OptiMEM (Gibco 31985062) ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral vectors were incubated with 3rd generation viral packaging vectors (pCMV-VSV-G, pMDLg/pRRE, pRSV-Rev) and LT-1 (Mirus, MIR-2305) in OPTI-MEM media for 30 minutes as described by the provider’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections were performed on 150 mm dishes (8 per condition) using Mirus TransIT®-LT1 Transfection Reagent (Mirus Bio) and Lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral vectors were co-transfected with packaging vectors VSVG and gag/pol in a ratio of 3:1:2 into HEK293T cells using Trans-IT Transfection reagent (Mirus). Viral supernatants were collected at 48 and 72 hr post-transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were plated in 6-well dishes and transfected with mEGFP-tagged DNAJC17 or deletion mutants using TransIt-LT1 reagent at a 3:1 ratio (Mirus). Cells were then trypsinized and replated on 4-well chambered coverglass (LabTek ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1 μl TransIT (Mirus Bio TransIT-mRNA transfection kit ...
-
bioRxiv - Microbiology 2020Quote: ... or Transit LT-1 (Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Transit LT-1 (Mirus).
-
bioRxiv - Microbiology 2022Quote: ... 1 µl of mRNA Boost Reagent and 1 µl of TransIT-mRNA Reagent (Mirus Bio) and incubated for 5 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... and psPAX2 at a ratio of 1:1:0.1 using TransIT-LT1 transfection reagent (Mirus). The resulting blend was then filtered through a cellulose acetate membrane (0.45 µm ...
-
bioRxiv - Molecular Biology 2020Quote: BHK-21 cells were transfected in 25 cm2 flasks with 8 µg per flask of infectious clone-derived RNA using TransIT transfection reagent (Mirus) as described previously (32) ...
-
bioRxiv - Molecular Biology 2024Quote: BHK-21 cells were transfected in 25 cm2 flasks with 8 µg per flask of infectious clone-derived RNA using TransIT transfection reagent (Mirus) as described previously (35) ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Neuroscience 2023Quote: ... and pHR: mU6-sgRNA-EF1A-puro-P2A-BFP (sgRNA-BFP) (1:1:1) using 24 μL TransIT®-LT1 Transfection Reagent (Mirus Bio, Cat. No. MIR 2300) in a final volume of 1000uL Opti-MEM medium (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were transfected with 1 μg of in vitro-transcribed J6/JFH-1 Rluc RNA or H77S.3/GLuc RNA using the TransIT mRNA transfection kit (Mirus Bio LLC) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... cells were transfected with 3 µg of either each GPC expression plasmid or pCAGGS empty vector using TransIT LT-1 reagent (Mirus, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then transiently transfected 1 µg pTA-Luc-NL4-3 and different amounts of pEGFP-SF2 using TransIT®-LT1 transfection reagent (Mirus Bio LLC) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: HEK 293T cells (106) were transfected in 6-well plates with corresponding plasmids with Transit LT1 transfection reagent (Mirus) following the manufacturer’s protocol ...