Labshake search
Citations for Mirus Bio :
51 - 100 of 164 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... together with the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at a 10:7.5:5 ratio using TransIT-293 reagent (Mirus). The supernatant containing the viral particles was collected 48 hrs after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cell Biology 2024Quote: ... the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at 10:7.5:5 ratio using TransIT-293 Transfection Reagent (MIR2704, Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... cells were transfected in triplicate with 12.5 ug total of pcDNA3 or pcDNA3-FLg50 using TransIT LT1 (Mirus) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Szczesny) and 0.8 μg EGFP-CHIP plasmid using Mirus reagents: 2 ul TransIT-293 (MIR 2700, Mirus) for transfection of HEK293 Flp-In T-REx cells and 2 ul Trans-IT-HeLa and 1.3 ul Monster (MIR 2900 ...
-
bioRxiv - Immunology 2022Quote: H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
bioRxiv - Cell Biology 2022Quote: Plasmids for expression of kinesin-1 or any of the kinesin-6 family motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP or GMAP210p-mRFP-2xFKBP at a ratio of 5:1 with TransIT-LT1 transfection reagent (Mirus). Eighteen hours after transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... plus pMK1221-control or −GR shRNA (2.88 ug shCtrl or shGR, respectively) using TransIT-293 Transfection Reagent (Mirus Bio) as instructed by the manufacturer ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK-293 TREx FlpIn EMX1-EGFP reporter cells were cultured in DMEM supplemented with 10% (v/v) FBS and 50 μg/mL hygromycin (Mirus).
-
bioRxiv - Cell Biology 2020Quote: ... transfected at confluence (Day -2) using Mirus TransIT-X2 transfection reagent (3ul per well; Mirus Bio LLC, US) and 250 ng plasmid DNA (either empty vector or FABP4 sgRNA) ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with 2 μg of DNA 24 - 48 hours before measurement using TransIT transfection reagents (Mirus). DRG neurons from adult (postnatal weeks 8–12 ...
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... The VSV-G pseudotyped lentivirus was packaged by 5 plasmid co-transfection of HEK293T cells using TansIT Transfection Reagent (Mirus Bio) in 15 cm culture dishes (The protocol describing production of lentiviral particles can be found at http://www.www.bu.edu/dbin/stemcells/protocols) ...
-
bioRxiv - Microbiology 2020Quote: ... were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The final CPER product was transfected into Vero E6-TMPRSS2 cells seeded into 6-well plates (~ 5 × 105 cells per well) by using the TransIT-X2 Dynamic Delivery System (Mirus Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... for transfection of HEK293 Flp-In T-REx cells and 2 ul Trans-IT-HeLa and 1.3 ul Monster (MIR 2900, Mirus) for HeLa Flp-In T-REx cells ...
-
bioRxiv - Neuroscience 2020Quote: ... and mRFP + Nuak 1 and 2 kinases was performed via chemical transfection using TransIT-X2 (Mirus Bio, Madison, WI) 48 hours following plating ...
-
bioRxiv - Microbiology 2020Quote: BHK-21 cells were seeded in 48-well plates at 5×104/well in DMEM-10% one day prior to transfection with 500ng of different species ACE2-expression constructs or empty vector (pDISPLAY) (Sup.Table.2) in OptiMEM and TransIT-X2 (Mirus) transfection reagent according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... cells were transfected with a plasmid encoding for SARS-CoV-2 S-glycoprotein (YP_009724390.1) harboring a C-terminal 19 aa truncation using TransIT-Lenti (Mirus Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caco-2 cells were plated (10·106 cells) in 500μl of the Ingenio electroporation solution (Mirus Vio, Wisconsin, USA). The transfected cells were selected using the antibiotic geneticin/G418 (Gibco-Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with 25 nM scramble or PLIN 5 siRNA (Dharmacon, Lafayette, CO, USA) using TransIT-TKO (Mirus Bio LLC) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg of total DNA and 8 mL TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Biophysics 2021Quote: ... δ and ε subunits in the ratio 2:1:1:1 (TransIT® 293 transfection reagent; Mirus Bio, Madison, WI). Electrophysiological experiments started ~48 hours post-transfection ...
-
bioRxiv - Neuroscience 2021Quote: TDP-43 inducible knockdown SH-SY5Y cells were electroporated with 2 μg of DNA with the Ingenio electroporation kit (Mirus) using the A-023 setting on an Amaxa II nucleofector (Lonza) ...
-
bioRxiv - Immunology 2020Quote: HEK293T cells were transiently transfected with mRNA encoding SARS-CoV-2 WT S or S-2P protein using a TranIT mRNA transfection kit (Mirus). After 24 hr ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral particles were produced by co-transfection of shRNA plasmids with psPAX and pMDG.2 in 293T cells using the Trans-IT LT-1 transfection reagent (Mirus). DM cells were infected by shRNA lentivirus twice via spinoculation in the presence of 5 μg/mL polybrene (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2019Quote: ... and pZIP-mCMV-ZsGreen-shRNA NT Control or mTOR plasmids (2 µg; Transomic) using the TransIT-LT1 transfection reagent (Mirus) as per manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... 4ug of packing plasmids psPAX.2 and 2ug of the envelope vector pMD2.G diluted in OptiMEM medium and Trans-Ltl transfection reagent (Mirus). For the generation of gRNA lentivirus ...
-
bioRxiv - Cell Biology 2020Quote: ... SK-MEL-2 cells were seeded on 18 mm coverslips at a density of 2 × 105 cells and transfected using TransIT-X2 (Mirus Bio) according to manufactures’ instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Iso-2 and Cdk1 and its mutant plasmids were transfected into the cells using TransIT-X2 transfection reagent (Mirus, cat# MIR6000). siRNA oligonucleotides specific for Rad 51 were purchased from Sigma (ESIRNA HUMAN RAD51 EHU045521) ...
-
bioRxiv - Genomics 2022Quote: ... in HK-2 human proximal tubule cells at approximately 70% confluency in 96-well plates by using TransIT-2020 Reagent (Mirus, #5404), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with 250 ng of a pCDNA3.1(+) vector encoding for the SARS-CoV-2 spike protein using the TransIT®-LT1 Transfection Reagent (Mirus Bio). Six hours post transfection (p.t.) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 x 105 cells were seeded in 12-well plates and transiently transfected with 2 μg of a plasmid encoding HCoV-OC43 N or eGFP with TransIT-LT1 Transfection Reagent (Mirus Bio). At indicated time post transfection ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors were produced in HEK-293T cells by co-transfection of the previously sequenced vector constructs with psPAX and pMDG.2 packaging plasmids using Trans-IT LT-1 (Mirus, MIR2700). HEK293T cells were incubated overnight at 37°C and the next day medium was changed for IMDM 10% HI-FBS ...
-
bioRxiv - Microbiology 2024Quote: ... 80% confluent monolayers of Vero E6 cells in 12-well plates were transfected with 1.0 μg per well of infectious SARS-CoV-2 BAC DNA or its mutated derivatives using TransIT®-LT1 transfection reagent according to manufacturer’s instructions (Mirus Bio). At 48 h post transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Two samples each were treated with Opti-MEM with 2 µg of transfection DNA (either pJG01, or negative control without DNA) along with TransIT-X2 transfection reagent (Mirus Bio) premixed and allowed to incubate 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were passaged to 12-well tissue culture plates at a density of 1.5×105 cells/well (3.9×104 cells/cm2) and transfected with 500 ng plasmid DNA using 2 uL of TransIT-X2 transfection reagent (Mirus Bio, #MIR6005) and 100 uL Opti-MEM I reduced serum medium (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: 293T cells were seeded at 2 × 105 cells/well in 6-well plates the day before transfection using TransIT-LT1 reagent (Mirus Bio LLC) at 3 μL transfection reagent/well as previously described 57 ...
-
bioRxiv - Microbiology 2022Quote: HEK293T were seeded at 2 × 105 cells/well in 6-well plates the day before transfection using TransIT-LT1 reagent (Mirus Bio LLC) at 5.8 μL transfection reagent/well ...
-
bioRxiv - Neuroscience 2023Quote: ... H1 plasmid library with the top 5 sgRNA per gene21 were transfected into HEK293s using the TransIT®-Lenti Transfection Reagent (Mirus, Cat. No. MIR 6606) along with third generation lentiviral packaging mix ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were transfected with a SARS-CoV-2 orf-expressing plasmid and the packaging plasmids using TransIT-LT1 transfection reagent (Mirus Bio, Madison, WI) according to the provider’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Primers were designed for the predicted coding region of Bma-LEC-1 and Bma-LEC-2 that incorporated restriction digest sites facilitating recombination into the pOETIC 6xHis Transfer Plasmid (Mirus Bio, Madison, WI) (Supplemental Materials 1) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Transient transfection of FLAG-NMNAT1 and FLAG-NMNAT2 constructs (see Supplemental Table 2) was performed at ∼60% confluence using TransIT®-LT1 transfection reagent (Mirus Bio, Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL TransIT-LT1 transfection reagent (Mirus Bio) was mixed with 15 µL Opti-MEM (Thermo ...
-
bioRxiv - Biophysics 2022Quote: ... and 3 μL of TransIt LT1 (Mirus #MIR2305). Stable clones were selected by growing in DMEM containing 0.5 μg/μL puromycin (Sigma-Aldrich #P8833-25MG ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were seeded into 14.5 cm dishes and transfected with 40 µg pTK-SM-N100-GFP-V5 expression vector using TransIT-2020 (Mirus Bio; 1 µg DNA: 2 µL reagent), delivered in Opti-MEM ...
-
bioRxiv - Genetics 2023Quote: ... and 50 µL TransIT-LT1 Transfection Reagent (Mirus, MIR 2300) were mixed at room temperature for 15 mins and then added to the cells ...
-
bioRxiv - Microbiology 2021Quote: ... using 3:1 TransIT-LT1 Transfection Reagent (Mirus Bio). Twenty-four hours later ...
-
bioRxiv - Microbiology 2022Quote: ... 3 ul of TransIT-LT1 reagent (Mirus Bio LLC) transfection agent was used per ug of DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µl Mirus TransIT-LT1 transfection reagent (Mirus #MIR2300), and up to 1 µg of plasmid DNA ...