Labshake search
Citations for Mirus Bio :
1 - 50 of 164 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v1 or hDel-v2 lentiviral sgRNA library at a target infection rate of 25% ...
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v3 lentiviral sgRNA library at a target infection rate of 10% ...
-
bioRxiv - Cancer Biology 2022Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Cancer Biology 2023Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transfected with 10 ug of the TRE library ± 5 ug of pcDNA3.1 containing a GPCR expression cassette using TransIT-2020 (Mirus Bio) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and VSV-G vectors at a 4:2:1 ratio with Mirus TransIT LT1 (Mirus Bio, LLC). Virus-containing supernatant was collected 48 and 72h after transfection and filtered through 0.45mm filters before concentration by ultracentrifugation (25,000 RPM for 2 hours with low decel) ...
-
bioRxiv - Cancer Biology 2024Quote: ... with a 4:2:1:1 ratio of the target:pMDLg:pMD2.G:pRSV-REV plasmids using Transit 293T reagent (Mirus). After 48 hours ...
-
bioRxiv - Microbiology 2020Quote: ... were transfected with 2·5 µg serine protease expression plasmid or empty vector using TransIT-X2 Dynamic Delivery System (Mirus). One day later ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ug plasmid DNA and 3 uL TransIT-LT1 transfection reagent (Mirus, Cat#2300) were diluted in 100 uL Opti-MEM Reduced-Serum Medium (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... purified using a Nucleospin kit (Machery-Nagel) and transfected into 2 mL of 293F cells (0.5 mL/mL) using TransIT-Lenti (Mirus bio). The virus was amplified ...
-
bioRxiv - Microbiology 2023Quote: ... Medium was changed 24 h later to 10 ml of 5 % FBS/DMEM and changed again 48 h later to 10 ml of 5 % FBS/DMEM containing 1 µg/ml of puromycin (Mirus). Cells were incubated in selection medium for 72 h ...
-
bioRxiv - Bioengineering 2022Quote: Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... were transfected at a 4:3:1 ratio using TransIT293 reagent into T225 flasks as indicated by the manufacturer (Mirus Bio). For individual sgRNA preparations ...
-
bioRxiv - Biochemistry 2022Quote: ... Lentivirus transfer vectors were packaged by co-transfection with psPAX2 and pMD2.G (4:3:1) using TransIT-2020 (Mirus Bio) in HEK293T cells ...
-
Self-organization of embryonic stem cells into a reproducible embryo model through epigenome editingbioRxiv - Developmental Biology 2024Quote: ... cells with successful integration were selected by addition of 100 ug/ml Hygromycin (Mirus Bio, MIR5930) for 4 days ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral vectors were co-transfected with packaging vectors VSVG and gag/pol in a ratio of 3:1:2 into HEK293T cells using Trans-IT Transfection reagent (Mirus). Viral supernatants were collected at 48 and 72 hr post-transfection ...
-
bioRxiv - Microbiology 2022Quote: ... or 2 µg of pPol1II-HA and 2 µg of pPol1II-NA) using TransIT-293 (Mirus). Virus supernatant was harvested 72 hours post-transfection and filtered through 0.22 µm filters ...
-
bioRxiv - Microbiology 2019Quote: ... were plated at 2 × 105 cells/mL in 2 mL in 6-well plates one day prior to transfection using TransIT-LT1 reagent (Mirus Bio LLC) with 3 μL of transfection reagent per μg of DNA ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2022Quote: ... or 2:2:1 (33) with TransIT®-LT1 transfection reagent (Mirus Bio LLC, Madison, WI, USA) and the plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL of Boost reagent (Mirus Bio) and 2 µL of TransIT mRNA reagent (Mirus Bio) ...
-
bioRxiv - Biophysics 2022Quote: ... and 100 ug ml-1 Streptomycin were passed to 10 cm dishes and co-transfected using TransIT (Mirus Bio) in an approximate 1:2.5 ratio with NTSR1 containing C-terminal Renilla luciferase (RLuc ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Control and BCAT1-KO U251 cells were reverse-transfected with 1µg/ml of TC3-R9P-3NLS pDNA using 1:2 of Trans-iT (Mirus). 48h after transfection ...
-
bioRxiv - Immunology 2021Quote: ... transfected with 44 μg plasmid encoding SARS-CoV-2 Spike (pCG1-SARS-2-S, Wuhan Hu-1) using Transit LT-1 (Mirus). The next day ...
-
bioRxiv - Microbiology 2022Quote: ... 293T cells on 96-well plate were co-transfected with a set of pGS-AVLQS and pSARS-CoV-2 Mpro or a set of pGS-RLKGG and pSARS-CoV-2 PLpro using TranIT-LT1 (Mirus Bio) in the presence of serial diluted S-217622 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 µL of TransIT mRNA reagent (Mirus Bio). Transfection reactions were incubated at room temperature for 3 minutes prior to drop-wise addition into each well ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transferred into cuvettes (2 mm gap, Mirus, MIR50121) and subjected for electroporation using Nucleofector2b (Lonza) ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Genomics 2020Quote: ... HEK293T cells (4 × 105 cells/ 6-well dish) were transfected using LT1 reagent (Mirus Bio) with HDV-EGFP (1 ug) ...
-
bioRxiv - Neuroscience 2021Quote: ... using 2 μL of TransIT-Insect transfection reagent (Mirus Bio Cat #6104). Medium was replaced with serum-containing medium 5 hours after transfection ...
-
bioRxiv - Biophysics 2022Quote: ... with ∼ 600ng DNA and 2 µL TransIT-LT1 transfection reagents (Mirus Bio Corporation) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... 2 µg of plasmid DNA was transfected per dish using Transit 293T (Mirus) following the manufacturer’s instructions and measured at least 48 h later.
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with 5 μg of pACT-GFP-actin using TransIT-Insect transfection reagent (Mirus Bio) and incubated for 2 d at 28°C in Grace’s media with 10% FBS and antibiotics (100 μg/ml penicillin/streptomycin and 0.25 μg/ml Amphotericin B) ...
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Microbiology 2021Quote: ... monolayers of BHK-T7 cells (4 × 105) cultured in 12-well plates were co-transfected using 2.5 μL of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Biophysics 2021Quote: ... monolayers of BHK-T7 cells (4 × 105) cultured in 12-well plates were co-transfected using 2.5 μL of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... monolayers of BHK-T7 cells (4×105) cultured in 12-well plates were co-transfected using 2.5 μl of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... monolayers of BHK-T7 cells (4 × 105) cultured in 12-well plates were co-transfected using 2.5 μL of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... monolayers of BHK-T7 cells (4 × 105) cultured in 12-well plates were co-transfected using 2.5 μL of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Biochemistry 2021Quote: ... monolayers of BHK-T7 cells (4 × 105) cultured in 12-well plates were co-transfected using 2.5 μL of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... Strains containing selectable markers were cultured on medium with 50 µg/mL hygromycin (Hygromycin B Solution, Mirus) or 25 µg/mL kanamycin (GoldBio ...
-
bioRxiv - Biophysics 2022Quote: ... with 600 – 1000 ng DNA and 2 μL TransIT-LT1 transfection reagents (Mirus Bio Corporation) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μg of pSBbi or pSBtet containing gene of interest using TransIT-LT1 transfection reagent (Mirus Bio), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 250 μl of OptiMEM media and supplemented with 2 μl TransIT-2020 Transfection Reagent (Mirus, MIR5400). The transfection mix was incubated 20 min at room temperature and then added to the cell culture for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 cells were transfected with lentiviral DNA following the Mirus-LT1 (Mirus MIR 2300) transfection protocol ...
-
bioRxiv - Microbiology 2019Quote: ... and varying input (50 ng for 5-site screen and 15 ng for 4-site screen) of MxA plasmids were co-transfected into HEK 293T cells using the reagent TransIT-LT1 (Mirus Bio) in a 96-well plate format ...