Labshake search
Citations for Biosearch Technologies :
1 - 50 of 185 citations for WAS Protein Family Member 3 WASF3 Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... NP(6)-BSA-biotin (Biosearch Technologies) was pre-incubated for 30 min with streptavidin-APC in a 1:1 molar ratio ...
-
bioRxiv - Immunology 2023Quote: ... NP-PE and NIP-biotin (both from Biosearch Technologies). Dead cells and doublets were excluded from analyses based on staining of 7-amino-actinomycin D (7-AAD ...
-
bioRxiv - Neuroscience 2019Quote: ... Biotin labeled probes for 18S and 28S rRNA (Stellaris, Biosearch technology), and 18mer oligo(dT)/oligo(dA ...
-
bioRxiv - Plant Biology 2022Quote: ... and each probe was synthesized with a 3’ amino modification (LGC Biosearch Technologies, CA) (Table S3) ...
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Genomics 2022Quote: ... The 3’ end of each oligonucleotide probe was fluorescently tagged using Quasar dyes (Biosearch technologies). Bl6-specific oligos were labelled with Quasar 570 and Cast-specific oligos labelled with Quasar 670 ...
-
bioRxiv - Cell Biology 2022Quote: ... Oligonucleotides with 3’ amino group (LGC Biosearch Technologies) were pooled and coupled with either Cy®3 Mono NHS Ester (GE healthcare ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Cell Biology 2021Quote: ... S4 cDNA was detected using a fluorogenic probe (5′-FAM [fluorescent fluorescein]-AGCGCGCAAGAGGGATGGGA-BHQ [black hole quencher]-1-3′; Biosearch Technologies).
-
bioRxiv - Genomics 2022Quote: ... The cell suspension was further incubated with biotinylated 4-Hydroxy-3-iodo-5-nitrophenylacetyl (NIP)15-BSA (Biosearch Technologies, N-1027-5) for 1.5h ...
-
bioRxiv - Immunology 2020Quote: ... with 4-hydroxy-3- nitrophenylacetyl-O-succinimide ester (Biosearch Technologies).
-
bioRxiv - Genetics 2020Quote: 4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
bioRxiv - Microbiology 2022Quote: ... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
bioRxiv - Immunology 2021Quote: ... with 100 μg 4-hydroxy-3-nitrophenyl acetyl (NP)-CGG (Biosearch Technologies) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2023Quote: ... All oligos were synthesized with a 3’ amine modification (LGC Biosearch Technologies). The oligos against a given gene (oligo set ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...
-
bioRxiv - Neuroscience 2022Quote: Probe sets targeting the 3’UTR of rat Atf3 (Stellaris probes, Biosearch technologies) were designed using the Stellaris probe-set designer tool to specifically detect the 3’UTR of the transcript and 3’end labelled with CalFluor590 ...
-
bioRxiv - Molecular Biology 2023Quote: Two sets of 3’-end biotinylated RNA oligonucleotides (LGC Biosearch Technologies; Risskov, Denmark) (Table S3 ...
-
bioRxiv - Genetics 2023Quote: ... The probes with 3’ MdC(TEG-Amino) modifications were then ordered from Biosearch Technologies in 96-well plate format ...
-
bioRxiv - Immunology 2023Quote: ... or 1 mg 4-hydroxy-3- nitrophenyl (NP)-OVA (LGC Biosearch Technologies, N-5051-100) by oral gavage with 5 μg cholera toxin (List Biological Labs ...
-
bioRxiv - Developmental Biology 2023Quote: ... Custom 20 nt oligonucleotides with a 3’NHS ester modification were obtained from Biosearch Technologies, conjugated to either Atto 565 (Sigma ...
-
bioRxiv - Immunology 2023Quote: Mice were injected intraperitoneally with 50μg of 4-hydroxy-3-nitrophenylacetyl (NP)-CGG (BioSearch Technologies) in PBS ...
-
bioRxiv - Genomics 2021Quote: ... 2021) and ordered oligonucleotides with a primary amine group on the 3’ end from Biosearch Technologies (see Supplementary Table 2 for probe sequences) ...
-
bioRxiv - Molecular Biology 2019Quote: ... to a 24mer DNA oligo containing a Quasar 670 (Cy5) fluorophore at the 3’ end (Biosearch Technologies) that was purified as described previously (He et al. ...
-
bioRxiv - Immunology 2021Quote: ... or 50 ug of alum-precipitated 4-Hydroxy-3-nitrophenylacetyl (NP)-chicken gamma globulin (CGG) (Biosearch Technologies). For adoptive transfer experiments ...
-
bioRxiv - Immunology 2021Quote: ... and incubating with anti-Ki-67 or 4-hydroxy-3-nitrophenylacetyl conjugated to phycoerythrin (NP-PE) (Biosearch Technologies) in Perm/Wash buffer for 30 min ...
-
bioRxiv - Immunology 2019Quote: Mice were immunized intra-peritoneally with 25 μg of 4-hydroxy-3-nitrophenylaceyl-lipopolysaccharide (NP-LPS) (Biosearch Technologies). Blood ...
-
bioRxiv - Immunology 2021Quote: 7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
bioRxiv - Immunology 2022Quote: ... we employed a prime-boost approach in which 8-10 wk old age and sex matched mice were immunized intraperitoneally (i.p.) with 200µg of 4-Hydroxy-3-nitrophenylacetyl-Keyhole Limpet Hemocyanin (NP-KLH, Biosearch Technologies) mixed with Complete Freund’s Adjuvant (CFA ...
-
bioRxiv - Immunology 2022Quote: ... mice were injected intraperitoneally with 100µg of 4-Hydroxy-3-nitrophenylacetyl hapten-17 (NP17)-OVA (Biosearch Technologies, 1µg/mL) mixed with Imject Alum (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... Immunizations/infections were performed intraperitoneally (ip) with 100μg of 4-hydroxy-3-nitrophenylaceyl-keyhole limpet hemocyanine (NP-KLH) (Biosearch Technologies) adjuvanted with alum (Inject Alum ...
-
bioRxiv - Immunology 2023Quote: ... animals were immunized by intrafootpad injection of 10μg of 4-hydroxy-3-nitrophenyl-acetyl (NP) hapten conjugated to the Keyhole limpet hemocyanin (NP-KLH) (Biosearch Technology) mixed with 10 µL of Imject™ Alum (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Custom Stellaris FISH probes were designed to recognize NL4-3 HIV-1 gag-pol reading frame nucleotides 386-4456 using the Stellaris RNA FISH Probe Designer 4.1 (Biosearch Technologies, Inc.) available online ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Cancer Biology 2022Quote: ... at the 5′ end as the reporter fluorophore and with Black Hole Quencher 1 (BHQ1) at the 3′ end as the quencher (Biosearch Technologies). qPCR reactions were performed in a 20-µL volume containing 100 ng genomic DNA template (estimated by UV spectrophotometry ...
-
bioRxiv - Immunology 2022Quote: Wt and TNS3 nc/nc littermates (8–12 weeks old) were immunized by intraperitoneal injection with 200 μg of 4-Hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG, Biosearch Technology) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: Mice (aged 2–6 months) were injected intraperitoneally with 50 μg of 4-hydroxy-3-nitrophenylacetyl conjugated to chicken gamma globulin (NP-CGG) (Biosearch Technologies) in Imject Alum (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Immunology 2024Quote: Six-to twelve-week-old mice were immunized with 25 g 4-Hydroxy-3-nitrophenylacetic hapten conjugated to AminoEthylCarboxyMethyl-Ficoll (NP-Ficoll, LGC Biosearch Technologies), 50 µg NP-CGG (Chicken Gamma Globulin ...
-
bioRxiv - Immunology 2020Quote: Mice were immunized with 50μg of NP-KLH (4-hydroxy-3-nitrophenylacetyl-Keyhole Limpet Hemocyaninin; conjugation ratio 29-33, Biosearch technologies N-5060) dissolved in PBS at 2mg/mL and emulsified at a 1:1 ratio with Imject Alum Adjuvant (ThermoFisher Scientific 77161) ...
-
bioRxiv - Immunology 2020Quote: ... with 100 μg of NP-CGG (in average 16 molecules of NP, 4-hydroxy-3-nitrophenyl acetyl, conjugated to one molecule of CGG, chicken γ-globulin; Biosearch Technologies) in the presence of 100 μl of alum (Imject® Alum adjuvant ...
-
bioRxiv - Immunology 2023Quote: ... by one or two intraperitoneal (i.p.) injections of 100 µg of 4-hydroxy-3-nitrophenylacetyl hapten (NP) conjugated to ovalbumin (NP-ova, Biosearch Technologies, Novato, CA), emulsified in 100 µL Imject® alum (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... genomic RNA was detected with a 5’ 6-carboxyfluorescein (FAM) and 3’ black hole quencher 1 (BHQ-1) labeled probe targeting nsp2 (Biosearch Technologies, Petaluma, CA), and RNA copy number was calculated by reference to an RNA standard derived from the MHV A fragment ...