Labshake search
Citations for Biosearch Technologies :
101 - 150 of 155 citations for 6H Thieno 2 3 b pyrrole 5 carboxylicacid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Custom Stellaris FISH probes were designed to recognize NL4-3 HIV-1 gag-pol reading frame nucleotides 386-4456 using the Stellaris RNA FISH Probe Designer 4.1 (Biosearch Technologies, Inc.) available online ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Cancer Biology 2022Quote: ... at the 5′ end as the reporter fluorophore and with Black Hole Quencher 1 (BHQ1) at the 3′ end as the quencher (Biosearch Technologies). qPCR reactions were performed in a 20-µL volume containing 100 ng genomic DNA template (estimated by UV spectrophotometry ...
-
bioRxiv - Immunology 2022Quote: Wt and TNS3 nc/nc littermates (8–12 weeks old) were immunized by intraperitoneal injection with 200 μg of 4-Hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG, Biosearch Technology) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: Mice (aged 2–6 months) were injected intraperitoneally with 50 μg of 4-hydroxy-3-nitrophenylacetyl conjugated to chicken gamma globulin (NP-CGG) (Biosearch Technologies) in Imject Alum (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Immunology 2024Quote: Six-to twelve-week-old mice were immunized with 25 g 4-Hydroxy-3-nitrophenylacetic hapten conjugated to AminoEthylCarboxyMethyl-Ficoll (NP-Ficoll, LGC Biosearch Technologies), 50 µg NP-CGG (Chicken Gamma Globulin ...
-
bioRxiv - Genomics 2019Quote: ... We then washed the coverslips with 2 mL of Wash buffer A (LGC Biosearch Technologies) at room temperature for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 smFISH probes were designed using Stellaris smFISH probe designer (Biosearch Technologies) available online at http://www.biosearchtech.com/stellaris-designer ...
-
bioRxiv - Immunology 2020Quote: Mice were immunized with 50μg of NP-KLH (4-hydroxy-3-nitrophenylacetyl-Keyhole Limpet Hemocyaninin; conjugation ratio 29-33, Biosearch technologies N-5060) dissolved in PBS at 2mg/mL and emulsified at a 1:1 ratio with Imject Alum Adjuvant (ThermoFisher Scientific 77161) ...
-
bioRxiv - Immunology 2020Quote: ... with 100 μg of NP-CGG (in average 16 molecules of NP, 4-hydroxy-3-nitrophenyl acetyl, conjugated to one molecule of CGG, chicken γ-globulin; Biosearch Technologies) in the presence of 100 μl of alum (Imject® Alum adjuvant ...
-
bioRxiv - Immunology 2023Quote: ... by one or two intraperitoneal (i.p.) injections of 100 µg of 4-hydroxy-3-nitrophenylacetyl hapten (NP) conjugated to ovalbumin (NP-ova, Biosearch Technologies, Novato, CA), emulsified in 100 µL Imject® alum (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... The EZH2 probe set was ordered from the Stellaris Design Ready Probe Sets (Biosearch Technologies VSMF-2123-5). All other RNA-FISH probe sets were custom designed using the Stellaris Probe Designer tool at the biosearchtech.com website ...
-
bioRxiv - Cell Biology 2023Quote: ... eGFP transcripts were detected using the pre-designed Quasar 570 probe set (Biosearch Technologies Inc., VSMF-1014-5).
-
bioRxiv - Immunology 2023Quote: 2-4 months old mice were immunized intraperitoneally with 100 μg of NP18-OVA (Biosearch technologies) in Imject Alum adjuvant (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-3 μL of HIV-1 RNA probe diluted in hybridization buffer (Stellaris RNA FISH Hybridization Buffer (Biosearch Tech. Cat# SMF-HB1-10)) and 10% formamide were spotted on coverslips and incubate overnight in humid conditions at 37C ...
-
bioRxiv - Immunology 2022Quote: ... 10-to 18-week-old mice were injected intraperitoneally with 100 μg of alum-precipitated 4-hydroxy-3-nitrophenylacetyl (NP)-chicken-gamma-globulin (CCG) (Biosearch Technologies, Novato, CA) in 200 μl sterile PBS (Gibco) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eIF4E-5 mRNA were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc., Novato, USA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Molecular Biology 2023Quote: ... 56 Subsequent IVT reaction producing 5′-triphosphorylated RNAs was performed with NxGen T7 RNA Polymerase (Biosearch Technologies #30223-1). For segment 8 of IAV MEGAscript T7 Transcription Kit (Thermo #AM1333 ...
-
bioRxiv - Genetics 2022Quote: ... slow-2 and pgl-1 using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Developmental Biology 2024Quote: ... and kl-2 exons were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc.) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% deionized formamide for 5 min, and incubated with hybridization mix (0.1 μM RNA FISH, 10% deionized formamide, in Hybridization Buffer (Biosearch Technologies)) overnight at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... respectively and a commercially available library of 48 probes was used to detect HOXA5 (cat # VSMF-2538-5) (Stellaris RNA FISH probes, Biosearch Technologies). Hybridization conditions and imaging were as previously described (Itzkovitz et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... was incubated for 5 minutes and ACTB probe set was hybridized in for 16 hours at 37°C with Hybridization buffer (LGC Biosearch Technologies). After hybridization ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous Cdc42 isoforms were detected with 5’ Cy5-labelled Stellaris probes to the exons 6 or 7 (probe sequences available upon request; BioSearch Tech.). Hybridization conditions for Stellaris probes for cultured neurons and for tissue sections was performed as recently described (Terenzio et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Immunology 2020Quote: T-cell dependent immune responses were induced by intraperitoneally injecting mice with NP-CGG (N-5055B-5, Biosearch Technologies, Novato CA), as follows ...
-
bioRxiv - Immunology 2020Quote: ... percentage of NP-binding B1-8hi cell were determined by staining a fraction of cells with 5 mg/mL NP(19)-PE (Biosearch Technologies) and analyzing by flow cytometry.
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Immunology 2023Quote: ... ICs were generated by coincubation of 10 μg/ml anti-TNP human IgG subclasses (clone 7B4) and 5 μg/ml BSA coupled with either an average of 4 or 33 TNP molecules (Biosearch Technologies) to mimic low or high valency ICs ...
-
bioRxiv - Molecular Biology 2023Quote: ... diluted 1:6 in nuclease free H2O and 5 µl were used for Kompetitive allele specific PCR (KASP) genotyping (LGC Biosearch Technology) (Supplementary Table 3) ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg/ml trinitrophenyl (TNP)-specific human IgG1-4 (clone 7B4) were incubated with 5 μg/ml TNP-conjugated BSA (TNP-33-BSA, BioSearch Technologies) in PBS for 3 hours gently shaking at 60 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... All SSOs used are RNA oligonucleotides with 2’-O-methyl modifications and phosphorothioate backbones (LGC Biosearch Technologies; Risskov, Denmark) (Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: HUDEP-2 cells were washed with PBS and DNA extracted using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and recovering for 90 minutes at 30 °C in 1 mL of Endura recovery media (Biosearch Technologies 60242-2). Cultures were then grown for 16 hours in 50 mL of 2xYT media with 100 µg/mL of carbenicillin ...
-
bioRxiv - Developmental Biology 2024Quote: ... the embryos underwent heat shock and were hybridized for 2 h at 38.5 °C in a humidity chamber with XIST Quasar 570 (125 nM; SMF-2038-1; BioSearch Technologies) in a hybridization buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... smFISH probes consisting of 20 nt oligonucleotides with 2 nt spacing were designed with Stellaris Probe Designer and synthesized by Biosearch Technologies. Probe sets complementary to cycB (CG3510 ...
-
bioRxiv - Microbiology 2021Quote: ... The abundance of SARS-CoV-2 genetic material was subsequently determined by quantitative PCR using a Taqman probe and primers (Biosearch Technologies). The primers and probe sequences for the were as recommended by BEI resources for compatability with synthetic RNA standards (# NR-52358).
-
bioRxiv - Genomics 2024Quote: ... The assembled plasmid pool was purified and concentrated with AMPure XP SPRI Reagent and used for transformation of Electrocompetent Endura Cells (#60242-2, Biosearch Technologies) following manufacturer’s instructions and a previously published protocol47 ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.
-
bioRxiv - Developmental Biology 2022Quote: ... and 12.5uM Stellaris custom nascent Quasar 570 RNA FISH probes (targeting intronic regions of top SOX6 cluster genes Bcas1 or Nfasc) (Biosearch Technologies, SMF-1063-5) overnight in the dark at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were washed with Stellaris Wash Buffer A solution (2 mL Stellaris RNA FISH Wash Buffer A (Biosearch Technologies SMF-WA1-60), 7 mL Nuclease-free water ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 25 µl of 10 µg/ml NP-BSA in PBS (N-5050XL-10-BS with loading ratio of 2 or N-5050H-10-BS with loading ratio of 36, both Biosearch Technologies/BioCat) overnight at 4 °C ...