Labshake search
Citations for Biosearch Technologies :
1 - 50 of 155 citations for 6H Thieno 2 3 b pyrrole 5 carboxylicacid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... with 4-hydroxy-3- nitrophenylacetyl-O-succinimide ester (Biosearch Technologies).
-
bioRxiv - Genetics 2020Quote: 4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
bioRxiv - Developmental Biology 2023Quote: ... Custom 20 nt oligonucleotides with a 3’NHS ester modification were obtained from Biosearch Technologies, conjugated to either Atto 565 (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2019Quote: ... to BHQ-10 succinimidyl ester (Biosearch Technologies). In a typical reaction ...
-
bioRxiv - Genomics 2021Quote: ... followed by a 5-minute wash in Wash buffer B (Biosearch Technologies, SMF-WB1-20). The coverslips were then mounted onto glass slides with Vectashield (VWR ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were then washed for 5 minutes with Wash Buffer B (Biosearch Technologies, SMF-WB1-20), before sections were mounted with VECTASHIELD® Hardset™ Antifade Mounting Medium with DAPI (Vector Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... A final wash step was performed using Wash buffer B (Biosearch Technologies Cat# SMF-WB1-2) for 5 mins before mounting coverslips with ProLong Gold Anti-Fade reagent (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Biophysics 2020Quote: ... BHQ-10 maleimide was prepared from BHQ-10 succinimidyl ester (Biosearch Technologies) as described for the related BHQ-3 molecule (36) ...
-
bioRxiv - Genomics 2022Quote: ... The cell suspension was further incubated with biotinylated 4-Hydroxy-3-iodo-5-nitrophenylacetyl (NIP)15-BSA (Biosearch Technologies, N-1027-5) for 1.5h ...
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the female- and male specific splice forms of doublesex (dsxF/dsxM) and Abdominal B (AbdB) (Supp Table 3) using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA). dsxF mRNA was labeled with Quasar 570 ...
-
bioRxiv - Immunology 2022Quote: ... NP-specific B cells or SA-specific B cells were detected with BCR specific binding with NP-PE (Biosearch Technologies) or SA-PE (BioLegend) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Coverslips were incubated in buffer B (Biosearch Technologies) containing DAPI for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then washed with Buffer B (Biosearch Technologies) for 10 minutes at room temperature.
-
bioRxiv - Cell Biology 2022Quote: ... and Wash Buffer B (Biosearch Technologies, SMF-WB1-20) are purchased from Biosearch Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... and Wash B Buffers were purchased from Biosearch Technologies. Hoechst stain was purchased from AnaSpec ...
-
bioRxiv - Cell Biology 2021Quote: ... S4 cDNA was detected using a fluorogenic probe (5′-FAM [fluorescent fluorescein]-AGCGCGCAAGAGGGATGGGA-BHQ [black hole quencher]-1-3′; Biosearch Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Additional washing step with Stellaris Wash Buffer B (Biosearch Tech) was performed for 5 min at RT before mounting the samples on the glass slides.
-
bioRxiv - Cell Biology 2023Quote: ... Hoechst stain was washed with Wash Buffer B (Biosearch Technologies) at room temperature in the dark for 5 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and nuclear counterstaining was performed using 1:10000 Hoechst 33342 in buffer A followed by two washings in buffer B (Stellaris RNA FISH Wash Buffer B (Biosearch Tech. Cat# SMF-WB1-20) and mounting the coverslips with mowiol.
-
bioRxiv - Microbiology 2019Quote: ... genomic RNA was detected with a 5’ 6-carboxyfluorescein (FAM) and 3’ black hole quencher 1 (BHQ-1) labeled probe targeting nsp2 (Biosearch Technologies, Petaluma, CA), and RNA copy number was calculated by reference to an RNA standard derived from the MHV A fragment ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Cells were then washed in 500 μL Wash Buffer B (Biosearch Technologies), and resuspended in 50 μL freshly filtered 5× saline-sodium citrate (SSC ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were incubated with wash B buffer (Biosearch Technologies, SMF-WB1-20) at RT for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... and stored in Wash Buffer B (LGC Biosearch Technologies, SMF-WB1-20) for imaging ...
-
bioRxiv - Genetics 2024Quote: ... arrested cells were released into rich media containing 200 mM hydroxyurea and 130 μM Edu (5-Ethynyl-2’-deoxyuridine) (Biosearch Technologies). Cells were harvested in G1 and after 60 minutes release into HU ...
-
bioRxiv - Genomics 2024Quote: ... Purified ligations were electrotransformed by combining 5 µL of ligation and 25 µL of Endura electrocompetent cells (Biosearch Technologies 60242-2) in a 0.1 cm Gene Pulser cuvette (Biorad 1652083 ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... and stored in Wash Buffer B (Cat# SMF-WA1-60, LGC Biosearch Technologies) for imaging ...
-
bioRxiv - Cancer Biology 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were washed with wash buffer B (Biosearch Technologies, Cat# SMF-WB1-20) and resuspend in a small drop (approximately 30 µl ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were incubated with Wash Buffer B (cat. # SMF-WB1-20, Biosearch technologies) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... and then washed once with wash buffer B (Biosearch Technologies, SMF-WB1-20) before imaging.
-
bioRxiv - Genomics 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were washed in Wash Buffer B (Biosearch Technologies SMF-WB1-20) for 5 minutes at room temperature in the dark ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 15 min and washed in RNA FISH Wash Buffer B (LGC Biosearch Technologies) for 5 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... Cells were then washed with 1 ml of Wash Buffer B (LGC Biosearch Technologies) at RT for 5 min ...
-
bioRxiv - Genomics 2023Quote: ... Cover glasses were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then resuspended in 1 mL wash buffer B (Biosearch Technologies, SMF-WB1-20), incubated for 2-5 minutes at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... Then the cells were washed briefly with Stellaris RNA FISH wash buffer B (Biosearch Technologies), rinsed three times with PBS and subject to imaging by deconvolution microscopy (DeltaVision OMX SR imaging system) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cells were then washed with Wash Buffer B (Biosearch Technologies, Inc., SMF-WA1-60) for 5 min ...
-
bioRxiv - Genetics 2023Quote: ... and finally with Stellaris RNA FISH Wash Buffer B (Biosearch Technologies Cat# SMF-WB1-20) for 5 minutes at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... washed with 500 μL Stellaris RNA FISH Wash Buffer B (Biosearch Technologies, SMF-WB1-20), and incubated in 500 μL Stellaris RNA FISH Wash Buffer B for 5 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... After washing with 1 mL of Stellaris® RNA FISH wash buffer B (Biosearch Technologies) cells were mounted in Vectashield® mounting medium (Vector Laboratories) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed with 200 μL of wash buffer B (Biosearch Technologies Cat# SMF-WB1-20) and incubated with it at room temperature for 2-5 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... at 37°C and then once with Stellaris wash buffer B (Biosearch technologies SMF-WB1-20) for three minutes at room temperature ...