Labshake search
Citations for Biosearch Technologies :
51 - 100 of 150 citations for 6 METHOXY 1 3 BENZODIOXOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... to a 24mer DNA oligo containing a Quasar 670 (Cy5) fluorophore at the 3’ end (Biosearch Technologies) that was purified as described previously (He et al. ...
-
bioRxiv - Immunology 2021Quote: ... or 50 ug of alum-precipitated 4-Hydroxy-3-nitrophenylacetyl (NP)-chicken gamma globulin (CGG) (Biosearch Technologies). For adoptive transfer experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... and custom synthesized conjugated with Quasar-670 dye (Biosearch Technologies, #SMF-1065-5). The pool of FISH probe set (5 nmol ...
-
bioRxiv - Immunology 2023Quote: ... Phosphorylcholine Keyhole Limpet Hemocyanin (PC-KLH, LGC Biosearch Technologies, Cat# PC-1013-5) was applied at a concentration of 100 ng per well ...
-
bioRxiv - Immunology 2021Quote: ... and incubating with anti-Ki-67 or 4-hydroxy-3-nitrophenylacetyl conjugated to phycoerythrin (NP-PE) (Biosearch Technologies) in Perm/Wash buffer for 30 min ...
-
bioRxiv - Immunology 2019Quote: Mice were immunized intra-peritoneally with 25 μg of 4-hydroxy-3-nitrophenylaceyl-lipopolysaccharide (NP-LPS) (Biosearch Technologies). Blood ...
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 100ug of NP(24)-CGG (Cat. N5055C-5, Biosearch technologies) emulsified in alum (Cat ...
-
bioRxiv - Immunology 2021Quote: 7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
bioRxiv - Immunology 2022Quote: ... we employed a prime-boost approach in which 8-10 wk old age and sex matched mice were immunized intraperitoneally (i.p.) with 200µg of 4-Hydroxy-3-nitrophenylacetyl-Keyhole Limpet Hemocyanin (NP-KLH, Biosearch Technologies) mixed with Complete Freund’s Adjuvant (CFA ...
-
bioRxiv - Immunology 2022Quote: ... mice were injected intraperitoneally with 100µg of 4-Hydroxy-3-nitrophenylacetyl hapten-17 (NP17)-OVA (Biosearch Technologies, 1µg/mL) mixed with Imject Alum (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... coverslips were incubated for 5 minutes in Stellaris RNA FISH Wash Buffer A (Biosearch Technologies), followed by hybridization overnight at 37°C with 250 nM of each FISH probe in 50 μl Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Genomics 2021Quote: ... followed by a 5-minute wash in Wash buffer B (Biosearch Technologies, SMF-WB1-20). The coverslips were then mounted onto glass slides with Vectashield (VWR ...
-
bioRxiv - Immunology 2022Quote: ... Immunizations/infections were performed intraperitoneally (ip) with 100μg of 4-hydroxy-3-nitrophenylaceyl-keyhole limpet hemocyanine (NP-KLH) (Biosearch Technologies) adjuvanted with alum (Inject Alum ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Immunology 2023Quote: ... animals were immunized by intrafootpad injection of 10μg of 4-hydroxy-3-nitrophenyl-acetyl (NP) hapten conjugated to the Keyhole limpet hemocyanin (NP-KLH) (Biosearch Technology) mixed with 10 µL of Imject™ Alum (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were then washed for 5 minutes with Wash Buffer B (Biosearch Technologies, SMF-WB1-20), before sections were mounted with VECTASHIELD® Hardset™ Antifade Mounting Medium with DAPI (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Immunology 2022Quote: Wt and TNS3 nc/nc littermates (8–12 weeks old) were immunized by intraperitoneal injection with 200 μg of 4-Hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG, Biosearch Technology) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: Mice (aged 2–6 months) were injected intraperitoneally with 50 μg of 4-hydroxy-3-nitrophenylacetyl conjugated to chicken gamma globulin (NP-CGG) (Biosearch Technologies) in Imject Alum (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Immunology 2024Quote: Six-to twelve-week-old mice were immunized with 25 g 4-Hydroxy-3-nitrophenylacetic hapten conjugated to AminoEthylCarboxyMethyl-Ficoll (NP-Ficoll, LGC Biosearch Technologies), 50 µg NP-CGG (Chicken Gamma Globulin ...
-
bioRxiv - Genomics 2023Quote: ... 1 mL of recovery media (Biosearch Technologies, 80026-1) was transferred to each culture tube in advance ...
-
bioRxiv - Immunology 2020Quote: Mice were immunized with 50μg of NP-KLH (4-hydroxy-3-nitrophenylacetyl-Keyhole Limpet Hemocyaninin; conjugation ratio 29-33, Biosearch technologies N-5060) dissolved in PBS at 2mg/mL and emulsified at a 1:1 ratio with Imject Alum Adjuvant (ThermoFisher Scientific 77161) ...
-
bioRxiv - Immunology 2020Quote: ... with 100 μg of NP-CGG (in average 16 molecules of NP, 4-hydroxy-3-nitrophenyl acetyl, conjugated to one molecule of CGG, chicken γ-globulin; Biosearch Technologies) in the presence of 100 μl of alum (Imject® Alum adjuvant ...
-
bioRxiv - Immunology 2023Quote: ... by one or two intraperitoneal (i.p.) injections of 100 µg of 4-hydroxy-3-nitrophenylacetyl hapten (NP) conjugated to ovalbumin (NP-ova, Biosearch Technologies, Novato, CA), emulsified in 100 µL Imject® alum (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... The EZH2 probe set was ordered from the Stellaris Design Ready Probe Sets (Biosearch Technologies VSMF-2123-5). All other RNA-FISH probe sets were custom designed using the Stellaris Probe Designer tool at the biosearchtech.com website ...
-
bioRxiv - Cell Biology 2023Quote: ... eGFP transcripts were detected using the pre-designed Quasar 570 probe set (Biosearch Technologies Inc., VSMF-1014-5).
-
bioRxiv - Immunology 2022Quote: ... 10-to 18-week-old mice were injected intraperitoneally with 100 μg of alum-precipitated 4-hydroxy-3-nitrophenylacetyl (NP)-chicken-gamma-globulin (CCG) (Biosearch Technologies, Novato, CA) in 200 μl sterile PBS (Gibco) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eIF4E-5 mRNA were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc., Novato, USA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the female- and male specific splice forms of doublesex (dsxF/dsxM) and Abdominal B (AbdB) (Supp Table 3) using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA). dsxF mRNA was labeled with Quasar 570 ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% deionized formamide for 5 min, and incubated with hybridization mix (0.1 μM RNA FISH, 10% deionized formamide, in Hybridization Buffer (Biosearch Technologies)) overnight at 37°C in the dark ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...
-
bioRxiv - Immunology 2024Quote: ... with a 1:1 mixture of 50 µg NP17-OVA ((Biosearch Technologies/BioCat) in PBS and Imject Alum (Thermo Fisher)) ...
-
bioRxiv - Genomics 2023Quote: ... 10 x 200 µL aliquots of extraction buffer (Dissociation Buffer, 1% Kollidon VA64, 1% Triton X100, 0.01% BSA, 666 units/mL RNase-inhibitor (Biosearch technologies, 30281-1)) were dispensed onto the puck for a total volume of 2 mL ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... respectively and a commercially available library of 48 probes was used to detect HOXA5 (cat # VSMF-2538-5) (Stellaris RNA FISH probes, Biosearch Technologies). Hybridization conditions and imaging were as previously described (Itzkovitz et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... was incubated for 5 minutes and ACTB probe set was hybridized in for 16 hours at 37°C with Hybridization buffer (LGC Biosearch Technologies). After hybridization ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Immunology 2020Quote: T-cell dependent immune responses were induced by intraperitoneally injecting mice with NP-CGG (N-5055B-5, Biosearch Technologies, Novato CA), as follows ...
-
bioRxiv - Immunology 2020Quote: ... percentage of NP-binding B1-8hi cell were determined by staining a fraction of cells with 5 mg/mL NP(19)-PE (Biosearch Technologies) and analyzing by flow cytometry.
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Immunology 2023Quote: ... ICs were generated by coincubation of 10 μg/ml anti-TNP human IgG subclasses (clone 7B4) and 5 μg/ml BSA coupled with either an average of 4 or 33 TNP molecules (Biosearch Technologies) to mimic low or high valency ICs ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg/ml trinitrophenyl (TNP)-specific human IgG1-4 (clone 7B4) were incubated with 5 μg/ml TNP-conjugated BSA (TNP-33-BSA, BioSearch Technologies) in PBS for 3 hours gently shaking at 60 rpm ...
-
bioRxiv - Genetics 2024Quote: ... arrested cells were released into rich media containing 200 mM hydroxyurea and 130 μM Edu (5-Ethynyl-2’-deoxyuridine) (Biosearch Technologies). Cells were harvested in G1 and after 60 minutes release into HU ...
-
bioRxiv - Genomics 2024Quote: ... Purified ligations were electrotransformed by combining 5 µL of ligation and 25 µL of Endura electrocompetent cells (Biosearch Technologies 60242-2) in a 0.1 cm Gene Pulser cuvette (Biorad 1652083 ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli (BioSearch Technologies 60345-1), and overnight cultures were grown in LB supplemented with 25 µg/mL kanamycin ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 12.5uM Stellaris custom nascent Quasar 570 RNA FISH probes (targeting intronic regions of top SOX6 cluster genes Bcas1 or Nfasc) (Biosearch Technologies, SMF-1063-5) overnight in the dark at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris RNA-FISH probes labelled with Quasar 570 Dye for NEAT1_2 (SMF-2037-1) (1:100, Biosearch Technologies) were used according to the instructions provided ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ethanol was left to evaporate at room temperature for 5 min and slides were then washed with Stellaris RNA FISH Wash Buffer A (Biosearch Technologies Cat# SMF-WA1-60). 100 μL of hybridization solution (containing 10% dextran sulfate ...