Labshake search
Citations for Biosearch Technologies :
1 - 50 of 150 citations for 6 METHOXY 1 3 BENZODIOXOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... All oligos were synthesized with a 3’ amine modification (LGC Biosearch Technologies). The oligos against a given gene (oligo set ...
-
bioRxiv - Microbiology 2019Quote: ... genomic RNA was detected with a 5’ 6-carboxyfluorescein (FAM) and 3’ black hole quencher 1 (BHQ-1) labeled probe targeting nsp2 (Biosearch Technologies, Petaluma, CA), and RNA copy number was calculated by reference to an RNA standard derived from the MHV A fragment ...
-
bioRxiv - Genomics 2021Quote: ... 2021) and ordered oligonucleotides with a primary amine group on the 3’ end from Biosearch Technologies (see Supplementary Table 2 for probe sequences) ...
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Bioengineering 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2023Quote: ... diluted 1:6 in nuclease free H2O and 5 µl were used for Kompetitive allele specific PCR (KASP) genotyping (LGC Biosearch Technology) (Supplementary Table 3) ...
-
bioRxiv - Microbiology 2022Quote: ... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... S4 cDNA was detected using a fluorogenic probe (5′-FAM [fluorescent fluorescein]-AGCGCGCAAGAGGGATGGGA-BHQ [black hole quencher]-1-3′; Biosearch Technologies).
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Genomics 2022Quote: ... The cell suspension was further incubated with biotinylated 4-Hydroxy-3-iodo-5-nitrophenylacetyl (NIP)15-BSA (Biosearch Technologies, N-1027-5) for 1.5h ...
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous Cdc42 isoforms were detected with 5’ Cy5-labelled Stellaris probes to the exons 6 or 7 (probe sequences available upon request; BioSearch Tech.). Hybridization conditions for Stellaris probes for cultured neurons and for tissue sections was performed as recently described (Terenzio et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Immunology 2021Quote: ... NP(6)-BSA-biotin (Biosearch Technologies) was pre-incubated for 30 min with streptavidin-APC in a 1:1 molar ratio ...
-
bioRxiv - Immunology 2023Quote: ... or 1 mg 4-hydroxy-3- nitrophenyl (NP)-OVA (LGC Biosearch Technologies, N-5051-100) by oral gavage with 5 μg cholera toxin (List Biological Labs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-3 μL of HIV-1 RNA probe diluted in hybridization buffer (Stellaris RNA FISH Hybridization Buffer (Biosearch Tech. Cat# SMF-HB1-10)) and 10% formamide were spotted on coverslips and incubate overnight in humid conditions at 37C ...
-
bioRxiv - Immunology 2021Quote: ... Staining was performed with 1 µM Cal Fluor 610 conjugated pals-5 smFISH probes (Biosearch Technologies) in smFISH hybridization buffer (10% formamide ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL Baseline-ZERO™ DNAse enzyme (LGC Biosearch Technologies, Pt# E0110-D1, 1 U/μL), 10 μL 10X Baseline-ZERO™ DNase Reaction Buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... Custom Stellaris FISH probes were designed to recognize NL4-3 HIV-1 gag-pol reading frame nucleotides 386-4456 using the Stellaris RNA FISH Probe Designer 4.1 (Biosearch Technologies, Inc.) available online ...
-
bioRxiv - Cancer Biology 2022Quote: ... at the 5′ end as the reporter fluorophore and with Black Hole Quencher 1 (BHQ1) at the 3′ end as the quencher (Biosearch Technologies). qPCR reactions were performed in a 20-µL volume containing 100 ng genomic DNA template (estimated by UV spectrophotometry ...
-
bioRxiv - Cell Biology 2022Quote: ... Oligonucleotides with 3’ amino group (LGC Biosearch Technologies) were pooled and coupled with either Cy®3 Mono NHS Ester (GE healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... 56 Subsequent IVT reaction producing 5′-triphosphorylated RNAs was performed with NxGen T7 RNA Polymerase (Biosearch Technologies #30223-1). For segment 8 of IAV MEGAscript T7 Transcription Kit (Thermo #AM1333 ...
-
bioRxiv - Immunology 2020Quote: ... with 4-hydroxy-3- nitrophenylacetyl-O-succinimide ester (Biosearch Technologies).
-
bioRxiv - Genetics 2020Quote: 4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
bioRxiv - Microbiology 2023Quote: ... and 5’-mono-phosphorylated v51_mut_S templates were specifically digested with a terminator 5’-phosphate-dependent exonuclease (Biosearch technologies) and subjected again to the Monarch RNA Cleanup Kit (NEB) ...
-
bioRxiv - Immunology 2022Quote: ... while TNP-BSA (load 5; LGC BioSearch Technologies) was used for the identification of TNP-specific antibody-secreting cells ...
-
bioRxiv - Genomics 2022Quote: ... 100μg NP-KLH (Biosearch Technologies, N-5060-5) plus 1μg LPS (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... or NP25-BSA (Biosearch Technologies, 5 μg/ml) to capture all murine Igs or NP-specific antibodies ...
-
bioRxiv - Immunology 2021Quote: ... C57BL/6 recipient mice were pre-immunized by intraperitoneal injection of 100 µg OVA (BioSearch Technologies) dissolved in PBS and precipitated in alum (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... with 100 μg 4-hydroxy-3-nitrophenyl acetyl (NP)-CGG (Biosearch Technologies) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2024Quote: Stellaris® FISH Probes recognizing either the coding region of eGFP mRNA or GAPDH mRNA labeled with Quasar® 670 Dye (VSMF-1015-5 for eGFP and SMF-2019-1 for GAPDH, from Biosearch Technologies, Inc., Petaluma, CA) were hybridized to HEK293T cell lines expressing integrated eGFP reporters with different length 3′UTRs according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... DesignReady Stellaris® probe sets against mCherry (labelled with Quasar®-670, # VSMF-1031-5) and GFP (labelled with Quasar®-570, # VSMF-1014-5) from Biosearch Technologies were used.
-
bioRxiv - Neuroscience 2022Quote: Probe sets targeting the 3’UTR of rat Atf3 (Stellaris probes, Biosearch technologies) were designed using the Stellaris probe-set designer tool to specifically detect the 3’UTR of the transcript and 3’end labelled with CalFluor590 ...
-
bioRxiv - Molecular Biology 2023Quote: Two sets of 3’-end biotinylated RNA oligonucleotides (LGC Biosearch Technologies; Risskov, Denmark) (Table S3 ...
-
bioRxiv - Biophysics 2023Quote: All oligonucleotides used in this work (Table S2) were synthesized using a MerMade 6 instrument (LGC, Biosearch Technologies) at 1 μmol scale ...
-
bioRxiv - Plant Biology 2022Quote: ... and each probe was synthesized with a 3’ amino modification (LGC Biosearch Technologies, CA) (Table S3) ...
-
bioRxiv - Genetics 2023Quote: ... The probes with 3’ MdC(TEG-Amino) modifications were then ordered from Biosearch Technologies in 96-well plate format ...
-
bioRxiv - Immunology 2019Quote: ... 7 and 14 with NP-KLH (N-5060-5 Biosearch Technologies) or PBS as a control ...
-
bioRxiv - Cell Biology 2022Quote: Human MYC_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2066-5), human ACTB_intron with Quasar 570 dye (Biosearch Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... human ACTB_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2002-5), Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Immunology 2023Quote: ... 50μg NP(30-39)-CGG (Biosearch Tech, cat: N-5055D-5) was mixed with Alum (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... 50μg NP(30-39)-CGG (Biosearch Tech, cat: N-5055D-5) in PBS was mixed with Imject Alum (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: ... Re-hydrated samples were hybridized with 62.5 nM of an equimolar mixture of Cy3-labelled DNA probes designed to target the coding region of the gene segment 6 of simian rotavirus A/SA11 (Genbank Acc. AY187029.1) using Stellaris Probe Designer v2 software (LCG Biosearch Technologies), in a total volume of 200 µl of the hybridization buffer (Stellaris RNA FISH hybridization buffer ...
-
bioRxiv - Genomics 2022Quote: ... The 3’ end of each oligonucleotide probe was fluorescently tagged using Quasar dyes (Biosearch technologies). Bl6-specific oligos were labelled with Quasar 570 and Cast-specific oligos labelled with Quasar 670 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Custom 20 nt oligonucleotides with a 3’NHS ester modification were obtained from Biosearch Technologies, conjugated to either Atto 565 (Sigma ...
-
bioRxiv - Immunology 2023Quote: Mice were injected intraperitoneally with 50μg of 4-hydroxy-3-nitrophenylacetyl (NP)-CGG (BioSearch Technologies) in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... the glass coverslips were transferred to a fresh 6-well plate with the cell side up and incubated with Wash Buffer A (Biosearch Technologies) and Hoechst stain (1:2000 ...