Labshake search
Citations for Biosearch Technologies :
1 - 50 of 795 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: Probes of Nanog were purchased from Stellaris (LGC Biosearch Technologies, Novato, CA) (http://www.singlemoleculefish.com/) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were re-fixed with 4% formaldehyde for 10 min and then hybridized with Stellaris RNA FISH probe for mouse Xist with Quasar 570 dye (BioSearch Tech, SMF-3011-1). First ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL Baseline-ZERO™ DNAse enzyme (LGC Biosearch Technologies, Pt# E0110-D1, 1 U/μL), 10 μL 10X Baseline-ZERO™ DNase Reaction Buffer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (Biosearch Technologies), prepared using the Mix & Go! E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (Biosearch Technologies).
-
bioRxiv - Molecular Biology 2024Quote: ... and copia was performed using Stellaris probes (Biosearch Technologies). Probe sequences are listed in Table S4.
-
bioRxiv - Neuroscience 2024Quote: ... see Table S2 for probe sequences) were designed using the Stellaris RNA-FISH Probe Designer 2.0 (LGC Biosearch Technologies) with non-specificity masking level 5 with the target sequence between the entire ins-6 open reading frame along with the 5’ and 3’ untranslated regions ...
-
bioRxiv - Bioengineering 2024Quote: ... Individual colonies were picked and gDNA was extracted using QuickExtract DNA extraction solution (Biosearch Technologies, cat.: QE09050). Knock-in was determined by ddPCR and INDELs were determined by ICE analysis as described above.
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were collected and genomic DNA was extracted using QuickExtract DNA extraction solution (Biosearch Technologies, cat.: QE09050). The following primer sequences were used to amplify the CCR5 locus around the sgRNA cut site as previously described:50
-
bioRxiv - Bioengineering 2024Quote: ... cells were collected and genomic DNA was extracted using QuickExtract DNA extraction solution (Biosearch Technologies, cat.: QE09050). In-out PCR was performed with 3 forward primers and one reverse primer to selectively amplify knock-in events of the Ibalizumab ...
-
bioRxiv - Microbiology 2024Quote: ... then electroporated into Endura Duo electrocompetent cells (Biosearch Technologies Cat. # 60242). Five hundred thousand colonies were pooled ...
-
bioRxiv - Microbiology 2024Quote: ... FailSafe PCR 2X PreMix D or G (LCG, Biosearch Technologies) were used as buffer for all PCR reactions.
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.4 U/µl of NxGen RNase inhibitor (Biosearch Technologies) and 1X Halt protease inhibitor (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: Genomic DNA was harvested with QuickExtract (LGC Biosearch Technologies) and amplified using KAPA HiFi polymerase with genomic site-specific primers ...
-
bioRxiv - Molecular Biology 2024Quote: QuickExtract (QE) DNA Extraction Solution (Biosearch Technologies, QE09050). Q5 High Fidelity 2X Master Mix (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The cells were sorted to rich recovery medium (LGC, Biosearch Technologies, Hoddesdon, UK) in a 1.5 ml centrifugation tube ...
-
bioRxiv - Molecular Biology 2024Quote: ... which were designed using the Stellaris probe designer software (Biosearch Technologies). Cells were grown in 6-well plates after placing round coverslips in the bottom of the wells (VWR) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was circularized by CircLigase I (LGC Biosearch Technologies) and amplified with 25 PCR cycles by Phusion High-Fidelity DNA polymerase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... each 20 nucleotides in length were designed to be complementary to the entire length of the genomic RNA sequence using Stellaris Probe Designer tool from Biosearch Technologies. The probes were synthesized with modified 3’ amino group and equimolar concentration of the probes were pooled for en mass conjugation with Texas Red (TR ...
-
bioRxiv - Plant Biology 2024Quote: ... homoeolog-specific KASP (Kompetitive Allele-Specific PCR, LGC Biosearch Technologies) primers were designed using Polymarker (Ramirez-Gonzalez ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was extracted using QuickExtract (QE) DNA Extraction Solution (Biosearch Technologies, QE09050). TrypLE Express Enzyme was added to cells ...
-
bioRxiv - Molecular Biology 2024Quote: A modified DNA extraction protocol was used to produce high molecular weight DNA based on the Lucigen/EpiCentre’s MasterPureTM Complete DNA and RNA Purification Kit A (Biosearch Technologies, Cat MC85200). For HG002 cell line ...
-
bioRxiv - Developmental Biology 2024Quote: ... Stellaris SM-FISH oligo-probes against Inx2 and CG43693/coch mRNAs were produced by Biosearch Technologies. FISH was performed according to the manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2024Quote: ... 25% QuickExtractTM RNA (Biosearch Technologies #SS000880-D2) and UltraPureTM DNase/RNase free distilled water (Invitrogen #10977015 ...
-
bioRxiv - Cell Biology 2024Quote: Probes targeting the genes of interest were designed using online website from Biosearch Technologies: https://www.biosearchtech.com/stellaris-designer ...
-
bioRxiv - Genetics 2024Quote: ... QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050) was used to collect genomic DNA (gDNA ...
-
bioRxiv - Genetics 2024Quote: ... HSPCs were harvested with QuickExtract DNA extraction solution (Biosearch Technologies, cat.: QE09050) to collect gDNA ...
-
bioRxiv - Biochemistry 2024Quote: ... coli (LGC Biosearch Technologies, Hoddesdon, UK). After the plasmids were confirmed by sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.
-
bioRxiv - Cell Biology 2024Quote: ... DesignReady Stellaris® probe sets against mCherry (labelled with Quasar®-670, # VSMF-1031-5) and GFP (labelled with Quasar®-570, # VSMF-1014-5) from Biosearch Technologies were used.
-
bioRxiv - Cell Biology 2024Quote: ... we used Stellaris® RNA Probes (LGC Biosearch Technologies). These probes consist of 48 single oligonucleotides ...
-
bioRxiv - Cell Biology 2024Quote: Stellaris Plp and GFP smFISH probes conjugated to Quasar 570 or 670 dyes (LGC Biosearch Technologies; Middlesex, UK) were designed against the coding region for each gene using the Stellaris RNA FISH probe designer [17 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Immunology 2024Quote: ... samples were incubated with Quasar 670-conjugated FISH probes that hybridize to Orsay virus RNA1 and RNA2 (Biosearch Technologies). Following a 6-8 h incubation at 47 °C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... RNA FISH probes were designed using the Stellaris RNA FISH platform (Biosearch Technologies) with the custom probe design service ...
-
bioRxiv - Genomics 2024Quote: ... The assembled plasmid pool was purified and concentrated with AMPure XP SPRI Reagent and used for transformation of Electrocompetent Endura Cells (#60242-2, Biosearch Technologies) following manufacturer’s instructions and a previously published protocol47 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... cloni 10G strain (LGC, Biosearch Technologies, Hoddesdon, UK) was used for all the cloning steps and plasmid amplification ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the genomic DNA of the cells (5U OD) was extracted using MasterPure Yeast DNA Purification Kit (Biosearch Technologies) before and after two cycles of PCA selection (S2 and MTX2) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Genomic DNA was extracted from samples at the two timepoints of the PCA experiment using MasterPure Yeast DNA Purification Kit (Biosearch Technologies).
-
bioRxiv - Evolutionary Biology 2024Quote: ... the genomic DNA of the cells (5U OD) was extracted using MasterPure Yeast DNA Purification Kit (Biosearch Technologies) before and after two cycles of PCA selection (S2 and MTX2) ...
-
bioRxiv - Genetics 2024Quote: ... DNA was isolated using QuickExtract (BioSearch Technologies), and PCR was performed using primers 5’ GTTGAAGGGAGCTTTGTGGG and 5’GAAGCCAGAAAGAGAGGGGT ...
-
bioRxiv - Genetics 2024Quote: Stellaris® FISH Probes recognizing either the coding region of eGFP mRNA or GAPDH mRNA labeled with Quasar® 670 Dye (VSMF-1015-5 for eGFP and SMF-2019-1 for GAPDH, from Biosearch Technologies, Inc., Petaluma, CA) were hybridized to HEK293T cell lines expressing integrated eGFP reporters with different length 3′UTRs according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... Genomic DNA was prepared from 0.5 ml of culture with the MasterPure Yeast DNA Purification kit (Biosearch Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... the embryos underwent heat shock and were hybridized for 2 h at 38.5 °C in a humidity chamber with XIST Quasar 570 (125 nM; SMF-2038-1; BioSearch Technologies) in a hybridization buffer ...
-
bioRxiv - Genetics 2024Quote: ... arrested cells were released into rich media containing 200 mM hydroxyurea and 130 μM Edu (5-Ethynyl-2’-deoxyuridine) (Biosearch Technologies). Cells were harvested in G1 and after 60 minutes release into HU ...
-
bioRxiv - Genetics 2024Quote: ... and incubated overnight with custom Stellaris oligonucleotide probes (Biosearch Technologies) labeled with CAL Fluor Red 610 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and kl-2 exons were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc.) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Genetics 2024Quote: ... The resultant library was electroporated in Endura DUO electrocompetent cells (Biosearch Technologies). Hundreds of thousands of colonies were isolated for sufficient coverage of the oligo library ...
-
bioRxiv - Genetics 2024Quote: ... cloni EXPRESS electrocompetent cells (Biosearch Technologies) along with a donor plasmid and an inactive Kanamycin resistance gene ...