Labshake search
Citations for Charles River Labs :
201 - 228 of 228 citations for Human Single stranded DNA binding protein 4 SSBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... we used the transgenic GFP P.berghei parasites (ANKA 2.34 strain) kept by serial passages into 3-4 weeks old female BALB/c mice (Charles River, Wilmington, MA) starting from frozen stocks ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.5–4-month-old outbred CD® (Sprague Dawley) rats were used (in house breeding, stock line originated from Charles River Laboratories). Outbred rat line was chosen for better translational value ...
-
bioRxiv - Neuroscience 2022Quote: To compare HFOs in the AD mouse models with HFOs recorded in animal models of epilepsy (n=6 IHKA; n=4 PILO) we used 8wk old C57BL/6J controls of Amigo2-Cre+/- mice (#027, Charles River Laboratories). IHKA- and PILO-treated mice were recorded at 3-4months after IHKA or PILO treatment.
-
bioRxiv - Genomics 2023Quote: ... Resuspended cells were kept on ice and inoculated into the pons of 4–6 week-old female Nod scid mice (Charles River Laboratory) by stereotactic injections at 1.5 mm to the right of midline ...
-
bioRxiv - Bioengineering 2023Quote: ... 1×107 PANC-1 cells in 150 μL of 1×PBS were injected in the right flank region of the mice (BALB/c nude, female, 4-5 weeks old, Charles River, USA).
-
bioRxiv - Bioengineering 2023Quote: ... 1×107 4T1 cells in 150 μL of 1×PBS were injected in the right flank region of the mice (BALB/c, female, 4-5 weeks old, Charles River, USA).
-
bioRxiv - Bioengineering 2023Quote: ... 1×107 Panc02 cells in 150 μL of 1×PBS were injected in the right flank region of the mice (C57BL/6, female, 4-5 weeks old, Charles River, USA).
-
bioRxiv - Neuroscience 2024Quote: We used 16 (8 eArch and 8 CTRL) male Long-Evans rats aged 4-6 months and weighing 430-600g (Charles River Laboratories), housed individually and kept under a 12hr light/dark cycle ...
-
bioRxiv - Cancer Biology 2023Quote: ... bone marrow (BM) cells were isolated from 4-week old female wild-type (WT) C57BL/6J (Charles River laboratories, North Wilmington, Mass) and STING-KO mice (C57BL/6J-Tmem173gt/J ...
-
bioRxiv - Genomics 2024Quote: ... Non-small cell lung cancer (NSCLC) PDX models were implanted subcutaneously in 4– 6-week-old female NMRI nude mice (Charles River, Germany) under isoflurane anesthesia ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Cell Biology 2020Quote: ... and injected subcutaneously into the flanks of 4-week-old immunocompromised Fox Chase Severe Combined Immunodeficiency (SCID) Beige mice (Charles River, Wilmington, MA) using a Hamilton syringe ...
-
bioRxiv - Neuroscience 2020Quote: ... Transverse hippocampal slices (350 µm thick) were prepared from sevoflurane-anesthetized adult C57Bl/6J mice (2 – 4 months old) of either sex purchased from Charles River (Sulzfeld, Germany). Adult animals (12 weeks old male or female mice ...
-
bioRxiv - Biochemistry 2023Quote: ... siRNA was administered subcutaneously (10 mg/kg) to 6-8-week old FVB/N female mice obtained from Charles River (n = 4/group). Microsamples of blood (10-20 μL ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Altogether 65 (comprising of 12-15 subjects/group) naturally aged (28 months old) and 12 young (4 months old) male Long Evans rats (Charles River Laboratories, Calco, Italy) weighing 350–500 g were applied in the current study ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...
-
bioRxiv - Biophysics 2020Quote: ... tumour was generated by injecting 1 × 106 MDA-MB-231 cells into the lower right MFP of 4 female NOD scid gamma (NSG) mice (6-7 weeks old; Charles River Laboratories, Wilmington, MA, USA). Cells were suspended in 0.05 mL of HBSS per injection ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Aggressive mice used for RSDS induction were 4-8 month-old retired breeder male mice of a CD-1 background (Charles River #022, Wilmington, MA, USA). All mice were caged with corncob bedding ...
-
bioRxiv - Neuroscience 2023Quote: ... C57BL/6J mice (7–8 weeks old) were acquired from The Jackson Laboratories and CD1 retired breeder mice (4–6 months old) from Charles River (St. Constant, QC, Canada). A total of 82 animals were used in this study ...
-
bioRxiv - Genetics 2020Quote: A 7 bp deletion at the beginning of the H2AFJ gene was introduced by a TALEN-mediated DNA break in the C57Bl/6-N (Charles River) genome by Cyagen ...
-
bioRxiv - Microbiology 2021Quote: ... Endotoxin levels were measured by the Limulus Amebocyte Lysate (LAL) kit (Charles River) and determined to be <0.8 EU/ml which is below the 5 EU/kg body weight set for intraperitoneal injection66 ...
-
bioRxiv - Bioengineering 2023Quote: ... The plate-reader based LAL assay was performed with the Endosafe Endochrome-K kit (Charles River, #R1708K), where a control standard endotoxin (CSE ...
-
bioRxiv - Biochemistry 2021Quote: ... all protein samples were brought to a final volume of 200 μL and the LPS content was measured using a commercial kit from Charles River Endosafe (R160) ...
-
bioRxiv - Immunology 2019Quote: ... The endotoxin content in the purified BLP was assessed by Limulus amebocyte lysate (LAL) assay using Endochrome – KTM kit (Charles River, SC, USA) as per manufacturer’s instructions.