Labshake search
Citations for Charles River Labs :
1 - 50 of 228 citations for Human Single stranded DNA binding protein 4 SSBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... was used to identify potential binding partners for multimerised human CACHD1 ectodomain (prepared as above) and was performed by Charles River Discovery Research Services UK Limited (formerly Retrogenix Limited ...
-
bioRxiv - Genomics 2022Quote: All genomic DNAs for this study were isolated from a single female LVG Golden Syrian hamster (SY011) that was purchased from Charles River, Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... Single-housed male CD1 retired breeder mice from Charles River laboratory (Wilmington ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Age-matched mice that had been castrated (n=4), ovariectomized (n=4), or sham-operated (n=4 male, n=4 female) by Charles River Laboratories were subjected to the isoproterenol regimen described above ...
-
bioRxiv - Bioengineering 2022Quote: ... and Rapid Single-Test LAL vials (Charles River Laboratories, cat. code r135) were used to establish qualitatively whether sample endotoxin levels were below a pre-specified threshold ...
-
bioRxiv - Microbiology 2023Quote: Bone marrow single cell suspensions were prepared from C57BL/6J mice (Charles River), by flushing tibias and femurs with RPMI 1640 medium using a 21 g needle ...
-
bioRxiv - Neuroscience 2021Quote: Mice (n = 4, C57BL/6J, male, 4-6 months, Charles River Laboratories, Inc.) were anesthetized with medical O2 vaporized isoflurane (3% for induction ...
-
bioRxiv - Bioengineering 2022Quote: Male and female pups were obtained from a single timed-pregnant Sprague Dawley rat (Charles River Laboratories ...
-
bioRxiv - Molecular Biology 2022Quote: ... male and female pups were obtained from a single timed-pregnant Sprague Dawley rat (Charles River Laboratories ...
-
bioRxiv - Pathology 2020Quote: Samples collected at preinfection and weekly post-infection until necropsy were tested for detection of binding IgG antibodies against SARS-CoV-2 nucleoprotein (NP) by MFIA COVID-Plex from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: Adult male (n=4) and female (n=4) Sprague Dawley rats (Charles River, Wilmington, MA) were shipped from the vendor at ~70 days of age ...
-
bioRxiv - Neuroscience 2023Quote: Eight male (N = 4) and female (N = 4) wildtype rats (Charles River Laboratories, Wilmington, MA) aged approximately 9 weeks at the time of surgery were included in this study to assess BLA neuronal activity changes across Pavlovian long-delay conditioning ...
-
bioRxiv - Physiology 2024Quote: A total of 38 animals were obtained as a single cohort (Charles River Laboratories, New York, USA), of which 26 underwent training into adulthood (Fig ...
-
bioRxiv - Developmental Biology 2019Quote: ... For the single cell analysis on WT embryos (WT-Ref) from the CD1 strain (Charles River or Janvier), embryos were also staged using littermates total cell counts.
-
bioRxiv - Cancer Biology 2020Quote: ... age 4-6 weeks (Charles River Laboratories) were subcutaneously injected with 1 × 105 MB49 cells in the right flank of hind leg ...
-
bioRxiv - Neuroscience 2022Quote: 4 male C57BL6/J mice (Charles River) were used in this study ...
-
bioRxiv - Cancer Biology 2023Quote: ... age 4-6 weeks (Charles River Laboratories) were subcutaneously injected with 1 x 105 MB49 cells in the right flank of hind leg ...
-
bioRxiv - Neuroscience 2021Quote: ... An additional 4 Long-Evans rats (Charles River) were trained and tested with yohimbine and muscimol but did not participate in the uncertainty experiment.
-
bioRxiv - Neuroscience 2022Quote: ... 4–6-week-old C57BL/6J (Charles River) mice were obtained from the Comparative Medicine facility at IMBA/IMP ...
-
bioRxiv - Microbiology 2023Quote: 4-week old BALB/c mice (Charles River) weighing approximately 20 to 25 g were used as a host model for virulence assays ...
-
bioRxiv - Immunology 2023Quote: Protein endotoxin levels were measured at 0.045 µg/mL using single-use cartridges (0.05 EU/mL, PTS2005) and the Endosafe® nexgen-PTS™ reader (Charles river). If endotoxin levels were > 0.015 EU/µg ...
-
bioRxiv - Neuroscience 2022Quote: Tissue lysates were prepared from acutely isolated cortexes and hippocampi of 4 male and 4 female C57BL/6J mice (Charles River) on ice and immediately homogenized in cold EBC lysis buffer (50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2023Quote: 7 week old Lewis rats with a limited Altered Schaedler Flora (n = 4 males, and 4 females) were purchased from Charles River Laboratories Inc ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were transplanted into the #4 epithelium-free “cleared” fat pad of 3–4-week-old SCID/Beige mice (Charles River Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... Male CD-1 retired breeders (Charles River, > 4 months) were used as the aggressors for CSDS/CWDS ...
-
bioRxiv - Neuroscience 2022Quote: ... Male CD-1 retired breeders (Charles River, >4 months) were used as aggressors in social defeat stress experiments ...
-
bioRxiv - Cancer Biology 2021Quote: Nude mice (4-6 weeks old) from Charles River Laboratory were injected right and left sides respectively with 200 μL Matrigel (Corning ...
-
bioRxiv - Neuroscience 2022Quote: 4 male Long-Evans rats (Charles River Laboratories, Inc.), 350-500g ...
-
bioRxiv - Bioengineering 2023Quote: 3-4 months old Long-Evans Rats (Charles River) were used in our experiments ...
-
bioRxiv - Neuroscience 2024Quote: Data from 4 male Long-Evans rats (Charles River RRID:RGD_2308852 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human brain metastatic cells were injected in Foxn1 Nu/Nu (Charles River, Germany) or NOD-scid IL2rγnull (NSG ...
-
bioRxiv - Neuroscience 2020Quote: Experiments were performed with 10 weeks-old male and female C57BL/6J mice (26±4 g and 20±4 g, respectively; Charles River, L’Arbresle, France). Animals were housed according to a 12 h light-dark cycle ...
-
bioRxiv - Neuroscience 2023Quote: Experiments were performed with ten weeks-old male and female C57BL/6J mice (26±4 g and 20±4 g, respectively; JAX:006362; Charles River, L’Arbresle, France). Male and female mice were group-housed at 5 per cage ...
-
bioRxiv - Cancer Biology 2020Quote: ... SCID-beige mice (4 to 6 weeks old; Charles River) were used for the SUDHL4 tumor xenograft study ...
-
bioRxiv - Neuroscience 2020Quote: Male 2-4 month old C57BL/6J mice (Charles River) were stereotaxically implanted with 26GA guide cannulas bilaterally (PlasticsOne ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Athymic nude mice (4-6 weeks, female) from Charles River Laboratories were housed under a 12-hr light/dark cycle with food and water ad libitum ...
-
bioRxiv - Immunology 2020Quote: 4-6 week old mice were purchased from Charles River or Jackson Laboratory ...
-
bioRxiv - Microbiology 2022Quote: Male CD1 mice (3- to 4-week-old; Charles River) were restrained with a 50 mL conical tube holes at both ends for ventilation ...
-
bioRxiv - Neuroscience 2023Quote: ... male Wistar rats (P39 ± 4, provided by Charles River Laboratories) were positioned in the recording setup using a head-post ...
-
bioRxiv - Neuroscience 2023Quote: ... Long-Evans rats (Charles River Laboratories, 4–8 months old) were successfully injected in CA1 with AAV9-GCaMP6f ...
-
bioRxiv - Microbiology 2023Quote: ... 4-6-week-old C57/BL6 mice from Charles River laboratories were used ...
-
bioRxiv - Neuroscience 2023Quote: ... and CHO cells stable expression of human NaV1.8 (CHO1.8) were obtained from Charles River, Neuronal NG108-15 (NG105 ...
-
bioRxiv - Immunology 2021Quote: Human CD4 knock-in (hCD4KI, genOway, Lyon, France) and wildtype C57BL/6J mice (Charles River) were injected intravenously with 5 µg (∼15 MBq ...
-
bioRxiv - Genetics 2023Quote: ... XYΔ mutant rats [SD-Del(Yp)1Mcwi (RGD:155663364)] were generated at MCW by pronuclear injection of these two CRISPR-Cas9 ribonucleoproteins targeting the sequences GCATGTGGGCAGTTTCCACCTGG and ACACAGCTCCTCTCTGGTAGAGG (protospacer adjacent motif underlined) into single-cell Crl:SD (Charles River Laboratories, Crl:SD strain code 400) embryos ...
-
bioRxiv - Microbiology 2020Quote: 4-week-old C57BL/6 female mice were purchased (Charles River) and housed in a BL-2 facility under conventional rearing conditions for the duration of the studies ...
-
bioRxiv - Cell Biology 2021Quote: Wild-type Sprague-Dawley rats (Male, 4-5 weeks, Charles River) were housed under a controlled environment with a 12-hour light-dark cycle and access to food and water ad libitum ...
-
bioRxiv - Bioengineering 2021Quote: Male CD1 mice aged 4-6 weeks old (Charles River Laboratories) were anesthetized using isoflurane and immobilized on a heated confocal microscope stage ...
-
bioRxiv - Neuroscience 2021Quote: ... Subjects were Long-Evans rats (n = 8; 4 females; Charles River Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Sprague-Dawley rats (4-month old) were purchased from Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2022Quote: ... at least 4 weeks old NSG mice obtained from Charles River Laboratories were used and the experiment was carried out as previously described(19) ...