Labshake search
Citations for Charles River Labs :
201 - 250 of 287 citations for Mouse Two pore calcium channel protein 2 Tpcn2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Adult (2-4 months of age) male (n = 92) Long-Evans rats (Charles River Laboratories, Kingston, NY) were pair housed in a vivarium in standard ventilated cages with ad libitum water and food ...
-
bioRxiv - Neuroscience 2020Quote: The following mouse strains/lines were used in this study: CD-1® IGS (Charles River Laboratories, Stock # 022); C57BL/6J (The Jackson Laboratory ...
-
bioRxiv - Immunology 2020Quote: ... C57BL/6 and OT-I laboratory mouse strains were bred in house at LSHTM or purchased from Charles River Laboratories (Margate ...
-
bioRxiv - Biochemistry 2023Quote: Primary neuronal cultures were obtained from cerebral cortex of mouse embryos at gestation day 14–16 (Charles River Laboratories). The neurons were dissociated using Papain Dissociation System (Worthington Biochemical Corporation ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Molecular Biology 2021Quote: The administration of 2′-O-MOE gapmer was performed in female FVB mice (Charles River Laboratories, Wilmington, MA), 8 weeks of age ...
-
bioRxiv - Cell Biology 2023Quote: Primary rat cortical astrocyte cultures were prepared from neonatal (1-2 day old) Sprague-Dawley rats (Charles River) as previously described (McCarthy and De Vellis 1980 ...
-
Perivascular Excitation Tunnelling: a Novel and Preventable Cause of Cardiac Reperfusion ArrhythmiasbioRxiv - Physiology 2023Quote: ... n=105 (reperfusions)) and 2-month-old (N=31) rabbits (strain code 052, Charles River Laboratories, Romans, France). Male or female rabbits were used indiscriminately based on availability (larger rabbits ...
-
bioRxiv - Cancer Biology 2019Quote: ... The specific pathogen free status of these cells was confirmed by PCR screening for mouse/rat comprehensive panel (Charles River). MC38 ...
-
bioRxiv - Molecular Biology 2021Quote: Collection of GAM data from dopaminergic neurons was performed using one C57Bl/6NCrl (RRID: IMSR_CR:027; WT) mouse which were purchased from Charles River, and from one TH-GFP (B6.Cg-Tg(TH-GFP)21-31/C57B6 ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Neuroscience 2020Quote: Sprague-Dawley female rats and their natural 2-day-old pups (10 pups/litter) were obtained from Charles River Laboratories (Wilmington ...
-
bioRxiv - Molecular Biology 2020Quote: ... One male from clone #1 and three males from clone #2 were crossed to Swiss Webster mice (Charles River) to assess germline transmission ...
-
bioRxiv - Molecular Biology 2021Quote: Male type 2 diabetic ZDF (fa/fa) rats and their non-diabetic littermates (wildtype) were sourced from Charles River, maintained on Purina 5008 diet (LabDiet ...
-
bioRxiv - Neuroscience 2022Quote: Adult male Sprague Dawley rats were used for experiments (Experiment 1, n = 15; Experiment 2, n = 15. Charles River, weight range ...
-
bioRxiv - Neuroscience 2021Quote: ... following birth each litter was transferred within 0-2 days to a lactating female CD1-IGS (Charles River:022) who had also given birth within 2 days of the experimental litter ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: For the bioavailability study young adult (2 mo old) animals with jugular vein catheters were purchased from Charles River for plasma multi-sampling and IV dosing ...
-
bioRxiv - Microbiology 2021Quote: Neutrophils were isolated from bone marrow of three female WT mice aged between 2 and 4 months (Charles River) per experiment ...
-
bioRxiv - Immunology 2021Quote: ... Sensory neurons from Trigeminal Ganglia (TG) of post-natal day 0-2 (P0-P2) CD1 mice (Charles River Laboratories) were dissected using the same protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Male 16p11.2dup/+ mice were then crossed for at least 2 generations on a C57BL/6N background (Charles River Laboratories) prior to experiments ...
-
bioRxiv - Physiology 2023Quote: Primary neonatal rat ventricular myocytes were isolated from 1 to 2-days old Sprague-Dawley rats (Charles River Laboratories) as previously described33 ...
-
bioRxiv - Molecular Biology 2024Quote: Primary cultures of glial cells were prepared from 2-day-old newborn rats (Sprague–Dawley, Charles River, Calco, Italy), following a standardized procedure [32][33] ...
-
bioRxiv - Bioengineering 2024Quote: A total of 4 adult male Sprague-Dawley rats (2-3 month old; 250-300 g) from Charles River Laboratories (Wilmington ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5×106 Trp53-/-ID8 cells/mouse were injected intraperitoneally (IP) in 6-week-old C57BL/6J female mice (Charles River, UK). At defined endpoint ...
-
bioRxiv - Neuroscience 2019Quote: ... For genes related to spatial distribution ISH was performed on tissue sections from wild type mouse brains (C57BL/6, Charles River). Adult mice were transcardially perfused with 1x PBS followed by 4% paraformaldehyde and post-fixation in 4%PFA overnight ...
-
bioRxiv - Immunology 2019Quote: ... Pb ANKA and Pb K173 stabilates were subjected to a Mouse/Rat Comprehensive Clear Panel for PCR infectious agent testing (PRIA, Charles River). Further detection and quantitation of LDV particles were done with a simple PCR LDV test (Charles River ...
-
bioRxiv - Microbiology 2021Quote: ... Six to wight week old female C57BL/6 mice were housed (n=10) and the mouse-adapted influenza strainsA/PR/8/34 (H1N1;PR8) were provided by Charles River Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: Sound-evoked neuronal responses were obtained via chronically-implanted electrodes in the right hemisphere auditory cortex of one 17-week-old male mouse (M. musculus, C57Bl/6, Charles River). All experimental procedures were carried out in accordance with the institutional animal welfare guidelines and a UK Home OZce Project License approved under the United Kingdom Animals (Scienti1c Procedures ...
-
bioRxiv - Genetics 2020Quote: ... approximately 15/mouse) into the fallopian tubes of CD1 female recipients rendered pseudopregnant by mating with B6C3F1 vasectomized males (purchased from Charles River).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Bone marrow derived cells (BMDCs) were obtained from a minimal-disease certified mouse (C57BL/6 -M. musculus- -B6-, Charles River, US). Femurs and tibias were dissected from the euthanised mouse and ...
-
bioRxiv - Microbiology 2020Quote: ... and were bred and maintained at VRI in a vivarium free from >40 murine pathogens as determined through biannual nucleic acid testing (Mouse Surveillance Plus PRIA; Charles River) of sentinel mice exposed to mixed bedding ...
-
bioRxiv - Physiology 2022Quote: Mouse-adapted IAV A/Puerto Rico/8/934 (H1N1) was propagated in 8-day old embryonated chicken eggs (Charles River Laboratories), diluted in DPBS containing Ca2+ and Mg2+ ...
-
bioRxiv - Neuroscience 2023Quote: Preparation and maintenance of dissociated spinal cord-DRG cultures from E13 CD1 mouse embryos (Charles River Laboratories, St. Constant, QC, Canada) were as previously described [22] ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 × 106 HCT116 or SW480 cells were implanted subcutaneously in 6-week-old female BALB/c nude mice (Charles River). For MC38 cells ...
-
bioRxiv - Neuroscience 2023Quote: 2-to-4-months old male Rosa26-floxed stop tdTomato mice and C57Bl6/J mice (initially obtained from Charles River) were used in this study ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: Three gerbil families (Meriones unguiculatus, n=6 per family: 2 adults, 4 pups) were used in this study (Charles River). All procedures related to the maintenance and use of animals were approved by the University Animal Welfare Committee at New York University ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: Three gerbil families (Meriones unguiculatus, n=6 per family: 2 adults, 4 pups) were used in this study (Charles River). All procedures related to the maintenance and use of animals were approved by the University Animal Welfare Committee at New York University ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... high-titer of lentiviral particles (mECE20 mixed with mCherry which allows the visualization of infected mice at harvest) were delivered into the amniotic cavity of embryonic day (E) 9 CD1/NCrl mouse embryos (Charles River Labs). Injections were performed under ultra-sound guidance using the Vevo 2100 ultrasound imaging system (Visualsonics ...
-
bioRxiv - Bioengineering 2022Quote: Cortical neurons and glial cells were harvested from the cortical hemispheres dissected from C57BL/6 mouse embryo brains at E15-16 (Charles River Laboratories). Pregnant mice were euthanized by cervical dislocation ...
-
bioRxiv - Biochemistry 2023Quote: Cortical neuron cultures were established from neonatal mouse brains (wild-type C57BL/6, Charles River, strain code 027, or the genotype(s) indicated for each experiment ...
-
bioRxiv - Immunology 2024Quote: mRNA-LNP and ChAdOx-1 pre-vaccinated mouse experiments were conducted using 6-7 week old female BALB/c mice (Charles River Laboratories) with 10-14 animals in each cohort.
-
bioRxiv - Cell Biology 2020Quote: ... Cells as single cell suspension (2×104 cells in 10 µL) were injected into the deep dermis of Balb/c nu/nu mice (Charles River) carrying a dorsal skin-fold chamber ...
-
bioRxiv - Biophysics 2020Quote: ... a 100 µ l aliquot of the 2 mg/ml Influenza A/PR/8/34 virus stock (Charles River, CT, USA) was thawed at room temperature and diluted using 50 µ l isotonic 145 mM NaCl/50 mM HEPES (pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: Sympathetic neurons from the superior cervical ganglia (SCG) of post-natal day 0–2 (P0-P2) CD1 Mice (Charles River Laboratories) were dissected as previously described (52) ...
-
bioRxiv - Microbiology 2022Quote: Six-weeks old C57 Bl/6 and C57 Bl/6 K18-hACE-2 transgenic [19] female mice were purchased from Charles River and hosted at the Central and BSL3 Animal Facilities of the Istituto Superiore di Sanità ...
-
bioRxiv - Neuroscience 2022Quote: ... The method of euthanasia used was lethal anesthesia with 170 mg/kg ketamine/ 2 mg/kg medetomidine via ( ketamine + medetomidine, intraperitoneal administration. Charles River Laboratories is the external animal facility used to acquire animals ...