Labshake search
Citations for Charles River Labs :
51 - 100 of 287 citations for Mouse Two pore calcium channel protein 2 Tpcn2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: Mouse tissues were provided by Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2021Quote: ... with a female C57BL6 mouse (Charles River). Following genotypic identification (Transnetyx ...
-
bioRxiv - Neuroscience 2023Quote: A timed-pregnant mouse (Charles River Laboratories) was deeply anesthetized at E17.5 with a mixture of ketamine (200 mg/kg ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: ... CD-1 outbred mouse strain (Charles River) was used to obtain wildtype embryos ...
-
bioRxiv - Neuroscience 2024Quote: ... E15.5-16.5 CD1 mouse (Charles River, France) embryo brains were dissected and washed in ice-cold 0.1M PBS containing 6.5 mg/ml glucose ...
-
bioRxiv - Neuroscience 2023Quote: Male and female Sprague Dawley rats (approximately two months of age) were used to generate offspring perinatally exposed to morphine or sterile saline (vehicle) for controls (Charles River Laboratories, Boston, MA). After weaning on P21 ...
-
bioRxiv - Physiology 2024Quote: ... Experiments were performed using male and female Dunkin-Harley guinea pigs procured from two premier suppliers of laboratory animals (Hilltop Lab Animals: Pennsylvania, US; Charles River Laboratories: Quebec, CA). Animals were housed in conventional acrylic cages within the research animal facility ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse: BALB/cAnNCrlCrlj (Charles River Laboratories, JAX: 000651); Primers for CTENO189 ...
-
bioRxiv - Cell Biology 2022Quote: ... an adult Swiss Webster mouse (Charles River Laboratories) four or eight weeks of age and of either sex was given buprenorphine subcutaneously at a dosage of 100 µg/kg for analgesia ...
-
bioRxiv - Neuroscience 2020Quote: ... The mouse breeders were purchased from Charles River, France (the purveyor of Jackson mice in Europe ...
-
bioRxiv - Genetics 2023Quote: ... XYΔ mutant rats [SD-Del(Yp)1Mcwi (RGD:155663364)] were generated at MCW by pronuclear injection of these two CRISPR-Cas9 ribonucleoproteins targeting the sequences GCATGTGGGCAGTTTCCACCTGG and ACACAGCTCCTCTCTGGTAGAGG (protospacer adjacent motif underlined) into single-cell Crl:SD (Charles River Laboratories, Crl:SD strain code 400) embryos ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse microglia were purified from CD1-IGS (Charles River) P0-P5 mouse pups ...
-
bioRxiv - Cancer Biology 2020Quote: ... estrogen supplemented (20) NCG mouse (Charles River, Wilmington, MA). Fulvestrant treatments began 7 days later with the following dosing regimen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: A minimal-disease certified mouse (B6, Charles River, US) was killed by cervical dislocation ...
-
bioRxiv - Neuroscience 2022Quote: C57BL/6N mouse lines were purchased from Charles River. The AAV vector expressing Cepheid1b-ST ...
-
bioRxiv - Neuroscience 2022Quote: Acute sagittal sections of the cerebellar vermis (∼200 μm thick) were prepared from 2 male and 2 female C57B6/J WT mice (P26–31; Charles River Germany ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 ΔORF6-YFP and SARS-CoV-2 ΔORF6-YFP ΔORF3c infected CaCo-2 wild-type cells and (2) transfected HEK293T cells infected with Sendai virus (Cantell Strain) (Charles River, l0l00774) for 8 hours ...
-
bioRxiv - Neuroscience 2023Quote: 2- to 3-month-old C57/Bl6N (Charles River) female mice were used in all experiments ...
-
bioRxiv - Neuroscience 2021Quote: Mouse studies: CD1 mice (gestation day 12.5; Charles River Laboratories) were housed (12 h dark/light cycle and less than 5 mice per cage ...
-
bioRxiv - Cancer Biology 2020Quote: ... C57Bl6 and immunocompromised mouse lines were purchased from Charles River.
-
bioRxiv - Immunology 2021Quote: ... Bone marrow cells were tested for mouse pathogens (Charles River) prior to use.
-
bioRxiv - Physiology 2022Quote: ... Mouse lines used in this study were: CD1 (Charles River), MafB-Cre (Wu et al. ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse lines: CD-1 mice were obtained from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: Male 2-4 month old C57BL/6J mice (Charles River) were stereotaxically implanted with 26GA guide cannulas bilaterally (PlasticsOne ...
-
bioRxiv - Neuroscience 2020Quote: Lister-hooded rats of 2 month of age (Charles River) were group housed with a 12 h:12 h light:dark cycle and water and food were provided ad libitum ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3-month old male C57BL6/N mice (Charles River) were injected daily ip with 10mg/kg/day of harmine or minipumps were implanted to deliver vehicle ...
-
bioRxiv - Neuroscience 2023Quote: Wildtype males (2-3 months of age; Charles River Laboratories) were housed in groups of 3-4 per cage ...
-
bioRxiv - Neuroscience 2023Quote: Adult (>2-month-old) male C57BL/6 mice (Charles River) were used for all experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... to each male SCID/Beige mouse (8-week old; Charles River), 100 μL of 2.5 × 106 cells/mL in DPBS was intracardially injected ...
-
bioRxiv - Cancer Biology 2020Quote: ... To each male SCID/Beige mouse (7-week old; Charles River), 100 μL of 1 × 107 cells/mL in DPBS was intracardially injected into the left cardiac ventricle ...
-
bioRxiv - Cancer Biology 2020Quote: ... For each male SCID/Beige mouse (7-week old; Charles River), 100 μL mixture was subcutaneously injected into both flanks ...
-
bioRxiv - Microbiology 2021Quote: ... three- to five-day-old mouse neonates (Charles River, Wilmington, MA) were orogastrically infected with approximately 106 bacterial cells following 2 hours of separation from dam mice and maintained at 30°C for 20h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A Male Balb/C mouse weighing 25 g (Charles River, UK), allowed free access to standard rodent chow and water ...
-
bioRxiv - Microbiology 2019Quote: ... Bacteria were opsonized with 10% BALB/c mouse serum (Charles River) in 10 volumes of DMEM for 30 min on ice ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were opsonised with 10% BALB/c mouse serum (Charles River) in 10 volumes of DMEM for 30 min on ice.
-
bioRxiv - Neuroscience 2024Quote: ... we used the following mouse lines: CD1 (ICR) (Charles River: 022) and Ai14 (Jackson Labs ...
-
bioRxiv - Cancer Biology 2023Quote: ... For each male SCID/Beige mouse (7-weeks-old; Charles River #CRL:250 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Experiments were performed on outbred strain CD1 mouse pups (Charles River Laboratories). Analyses are thought to include animals of both sexes at approximately equal proportions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse experiments: 6-8 weeks-old female BalB/c mice (Charles River) were used in all experiments ...
-
bioRxiv - Neuroscience 2021Quote: The C57BL/6J mouse line was used as background strain (Charles River). Mice expressing Cre from the Pitx3 locus and Cre induced YFP from the Rosa26 were previously described (35 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Immunology 2023Quote: ... B6.SJL-PtprcaPepcb/BoyCrl (CD45.1) mouse stain was obtained from Charles River Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Primary DRGs were cultured from E13.5 CD1 mouse embryos (Charles River Laboratories). DRGs were dissected in DMEM ...
-
bioRxiv - Cell Biology 2024Quote: The mouse strains used in this study were purchased from Charles River Laboratories (ICR mice ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Postnatal day 2 (P2) chicken feet were purchased from Charles River Laboratories.
-
bioRxiv - Neuroscience 2024Quote: Experiments used 2-4 month old Sprague Dawley rats (Charles River) and 2-4 month old sighted-FVB129 mice of both sexes ...
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...