Labshake search
Citations for Charles River Labs :
201 - 250 of 5526 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Non-small cell lung cancer (NSCLC) PDX models were implanted subcutaneously in 4– 6-week-old female NMRI nude mice (Charles River, Germany) under isoflurane anesthesia ...
-
bioRxiv - Neuroscience 2024Quote: The IUE surgery was performed as described previously.9 Timed-pregnant female CD1 mice (embryonic day 15.5, E15.5; Charles River) were deeply anesthetized and maintained with 2% isoflurane ...
-
bioRxiv - Neuroscience 2024Quote: C57BL/6 male mice (Charles River Laboratories, Wilmington, MA) were 8-10 weeks of age at the start of the experiments ...
-
bioRxiv - Neuroscience 2024Quote: Mice used in ex vivo experiments and in vivo DA recordings were adult male C57Bl6/J mice (Charles River, UK) (21-40 days) ...
-
bioRxiv - Neuroscience 2024Quote: Male C57BL/6 mice (8-10 weeks old, 20-26g) were purchased from Charles River Laboratories (Sulzfeld ...
-
bioRxiv - Neuroscience 2024Quote: 8- to 12-week-old male C57BL/6 mice were purchased from Charles River Laboratories or Jackson Laboratories and housed at the University of California ...
-
bioRxiv - Neuroscience 2024Quote: Rat primary cortical cultures were prepared from Sprague-Dawley rats (Charles River Laboratories L’Arbresle, France) at postnatal day 1 ...
-
bioRxiv - Neuroscience 2024Quote: Naïve male Sprague Dawley rats (150-180 g at their arrival in the laboratory, Charles River, L’Arbresle, France) were housed in a humidity (50-55% ...
-
bioRxiv - Neuroscience 2024Quote: ... and five rats that were identified as significant outliers with a z-score ≥ 5 on at least one measure (n=1 F CORT Charles River, n= 2 F VEH Charles River, n=1 M VEH Taconic, n=1 M CORT Taconic). Statistical analyses were conducted on the remaining rats (Table 1).
-
bioRxiv - Neuroscience 2024Quote: ... and 32 female rats were from Charles River Breeding Labs (colonies R04 and R08 Raleigh ...
-
bioRxiv - Neuroscience 2024Quote: ... and five rats that were identified as significant outliers with a z-score ≥ 5 on at least one measure (n=1 F CORT Charles River, n= 2 F VEH Charles River ...
-
bioRxiv - Neuroscience 2024Quote: ... due to equipment malfunction and one (n=1 CORT Charles River) was identified as a significant outlier with a z-score ≥ 5 for at least one of the measures ...
-
bioRxiv - Neuroscience 2024Quote: ... Conditioned reinforcement test data was excluded for all measures for two additional rats—one (n=1 CORT Charles River) due to equipment malfunction and one (n=1 CORT Charles River ...
-
bioRxiv - Neuroscience 2024Quote: ... while the second round consisted of 30 rats from Charles River Breeding Labs (colony R04 Raleigh ...
-
bioRxiv - Neuroscience 2024Quote: ... 22 rats were from Taconic Biosciences (colony IBU16, Cambridge City, IN, USA) and 32 rats were from Charles River Breeding Labs (colony R04 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 32 male rats were from Charles River Breeding Labs (colonies R04 and R08 Raleigh ...
-
bioRxiv - Neuroscience 2024Quote: ... Two rats were excluded from all analyses—one rat (n=1 Male VEH Charles River) died on the second day of injections in the experiment ...
-
bioRxiv - Neuroscience 2024Quote: ... Two rats were excluded from all PavCA and CRT analyses due to equipment malfunction (n=2 CORT Charles River). Statistical analyses were conducted on the remaining rats (Table 1).
-
bioRxiv - Neuroscience 2024Quote: Male and female Sprague Dawley rats (age 3–7 weeks; Charles River Laboratories) were anesthetized with isoflurane ...
-
bioRxiv - Neuroscience 2024Quote: Experiments were performed on a total of 27 C57BL/6NCrl male mice (Charles River, UK) and on a total of 88 C57BL/6J male mice from an in-house colony (IL-1αfl/fl and IL-1αfl/fl:Cx3cr1ERT2 ...
-
bioRxiv - Immunology 2024Quote: ... BALB/c mice were purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... male Sprague-Dawley rats (n=12) (Charles River, Wilmington, MA, USA) weighing between 250-300 grams were kept under 12 h reverse light-dark cycles with food and water ad libitum and randomly assigned to the sham group (n=6 ...
-
bioRxiv - Microbiology 2024Quote: Mouse fecal samples were collected from nine female C3H/HeN mice purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... CD-1 animals were imported from Charles River (#022) and C57BL/6 animals were imported from The Jackson Laboratory (#000664) ...
-
bioRxiv - Neuroscience 2024Quote: ... CD1 retired breeders were obtained from Charles River Laboratories (Saint-Constant ...
-
bioRxiv - Neuroscience 2024Quote: C57BL/6 mice were obtained from Charles River Laboratories (Saint-Constant ...
-
bioRxiv - Immunology 2024Quote: 8 week old (8 wk) C57BL/6 mice were purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2024Quote: ... WT C57BL/6 female mice were purchased from Charles River and used to test small molecules in EAE as further described below.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Five-week-old male SD rats were obtained from Charles River Laboratories Japan ...
-
bioRxiv - Neuroscience 2024Quote: ... Intruders used were group-housed BALB/c males or group-housed C57BL/6 females (both 10-36 weeks, Charles River). Mice were housed at 18-23 °C with 40-60% humidity and maintained on a reversed 12-h light/dark cycle (dark cycle starts at 10 a.m. ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary cortical neurons were obtained from SD rat E15 embryos (Charles River Laboratory). Dissociated cells were washed and triturated with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... 18 female Mongolian gerbils (Charles River Laboratories, Sulzfeld, Germany) aged between 30 and 60 days were used.
-
bioRxiv - Neuroscience 2024Quote: ... C57BL/6 wild-type female mice were purchased from Charles River International ...
-
bioRxiv - Neuroscience 2024Quote: ... Syrian hamsters were purchased from Charles River Laboratories and single housed in a 14-hour light/10-h dark cycle ...
-
bioRxiv - Neuroscience 2024Quote: ... Male and female Amigo2-icreERT2 mice were bred in house on a B6 background as described in [43] CD1 male mice were received from Charles River laboratories at 1-2 months of age ...
-
bioRxiv - Neuroscience 2024Quote: Wild type female and male C57BL/6 mice (adult, ∼12 wk of age) were obtained from Charles River (Scanbur AB). Knock-in mice strains FosdsTVA (Fos-2A-dsTVA ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Neuroscience 2024Quote: ... Administration of CORT enhanced lever-cue contacts selectively in male rats from Charles River (treatment x vendor ...
-
bioRxiv - Neuroscience 2024Quote: ... male rats from Charles River had a greater number of contacts with the lever-cue (effect of vendor ...
-
bioRxiv - Neuroscience 2024Quote: ... male rats from Charles River had a tendency to exhibit a greater number of lever-cue contacts upon its presentation during the conditioned reinforcement test (trend for effect of vendor ...
-
bioRxiv - Neuroscience 2024Quote: ... Administration of CORT increased the propensity to sign-track in (c) male rats from Charles River compared to their VEH counterparts (post hoc ...
-
bioRxiv - Neuroscience 2024Quote: ... and the probability to approach the food cup (treatment x vendor: p=0.035, post hoc: ***p=0.001) in male rats from Charles River.
-
bioRxiv - Neuroscience 2024Quote: ... were placed in the home cage of adult male CD1 mice (3-10 months of age, Charles River), which had been prescreened for aggression prior to encountering the subject mice ...
-
bioRxiv - Neuroscience 2024Quote: ... were purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: 81 male Long-Evans rats (250-300 g) were obtained from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2024Quote: ... Adult C57BL/6J wildtype (WT) mice were obtained from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... male and female C57BL/6 mice to be used as “strangers” were obtained from Charles River Laboratories (Saint-Constant ...
-
bioRxiv - Neuroscience 2024Quote: ... CD-1 mice (Strain: 022) were purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... and were transferred into the oviducts of pseudopregnant ICR females (Charles River). Successful insertions of 3×HA were detected by PCR genotyping of mouse tails and confirmed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... and were transferred into the oviducts of pseudopregnant ICR females (Charles River). Successful insertions of two LoxP sites were detected by PCR genotyping of mouse tails and confirmed by Sanger sequencing (Fig ...