Labshake search
Citations for Charles River Labs :
151 - 200 of 5872 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... while the second round consisted of 30 rats from Charles River Breeding Labs (colony R04 Raleigh ...
-
bioRxiv - Neuroscience 2024Quote: ... 22 rats were from Taconic Biosciences (colony IBU16, Cambridge City, IN, USA) and 32 rats were from Charles River Breeding Labs (colony R04 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 32 male rats were from Charles River Breeding Labs (colonies R04 and R08 Raleigh ...
-
bioRxiv - Neuroscience 2024Quote: ... Two rats were excluded from all analyses—one rat (n=1 Male VEH Charles River) died on the second day of injections in the experiment ...
-
bioRxiv - Neuroscience 2024Quote: ... Two rats were excluded from all PavCA and CRT analyses due to equipment malfunction (n=2 CORT Charles River). Statistical analyses were conducted on the remaining rats (Table 1).
-
bioRxiv - Neuroscience 2024Quote: Male and female Sprague Dawley rats (age 3–7 weeks; Charles River Laboratories) were anesthetized with isoflurane ...
-
bioRxiv - Neuroscience 2024Quote: Experiments were performed on a total of 27 C57BL/6NCrl male mice (Charles River, UK) and on a total of 88 C57BL/6J male mice from an in-house colony (IL-1αfl/fl and IL-1αfl/fl:Cx3cr1ERT2 ...
-
bioRxiv - Immunology 2024Quote: ... BALB/c mice were purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... male Sprague-Dawley rats (n=12) (Charles River, Wilmington, MA, USA) weighing between 250-300 grams were kept under 12 h reverse light-dark cycles with food and water ad libitum and randomly assigned to the sham group (n=6 ...
-
bioRxiv - Microbiology 2024Quote: Mouse fecal samples were collected from nine female C3H/HeN mice purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... CD-1 animals were imported from Charles River (#022) and C57BL/6 animals were imported from The Jackson Laboratory (#000664) ...
-
bioRxiv - Neuroscience 2024Quote: ... CD1 retired breeders were obtained from Charles River Laboratories (Saint-Constant ...
-
bioRxiv - Neuroscience 2024Quote: C57BL/6 mice were obtained from Charles River Laboratories (Saint-Constant ...
-
bioRxiv - Immunology 2024Quote: 8 week old (8 wk) C57BL/6 mice were purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2024Quote: ... WT C57BL/6 female mice were purchased from Charles River and used to test small molecules in EAE as further described below.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Five-week-old male SD rats were obtained from Charles River Laboratories Japan ...
-
bioRxiv - Neuroscience 2024Quote: ... Intruders used were group-housed BALB/c males or group-housed C57BL/6 females (both 10-36 weeks, Charles River). Mice were housed at 18-23 °C with 40-60% humidity and maintained on a reversed 12-h light/dark cycle (dark cycle starts at 10 a.m. ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary cortical neurons were obtained from SD rat E15 embryos (Charles River Laboratory). Dissociated cells were washed and triturated with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... 18 female Mongolian gerbils (Charles River Laboratories, Sulzfeld, Germany) aged between 30 and 60 days were used.
-
bioRxiv - Neuroscience 2024Quote: ... C57BL/6 wild-type female mice were purchased from Charles River International ...
-
bioRxiv - Neuroscience 2024Quote: ... Syrian hamsters were purchased from Charles River Laboratories and single housed in a 14-hour light/10-h dark cycle ...
-
bioRxiv - Neuroscience 2024Quote: ... Male and female Amigo2-icreERT2 mice were bred in house on a B6 background as described in [43] CD1 male mice were received from Charles River laboratories at 1-2 months of age ...
-
bioRxiv - Neuroscience 2024Quote: Wild type female and male C57BL/6 mice (adult, ∼12 wk of age) were obtained from Charles River (Scanbur AB). Knock-in mice strains FosdsTVA (Fos-2A-dsTVA ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Neuroscience 2024Quote: ... Administration of CORT enhanced lever-cue contacts selectively in male rats from Charles River (treatment x vendor ...
-
bioRxiv - Neuroscience 2024Quote: ... male rats from Charles River had a greater number of contacts with the lever-cue (effect of vendor ...
-
bioRxiv - Neuroscience 2024Quote: ... male rats from Charles River had a tendency to exhibit a greater number of lever-cue contacts upon its presentation during the conditioned reinforcement test (trend for effect of vendor ...
-
bioRxiv - Neuroscience 2024Quote: ... Administration of CORT increased the propensity to sign-track in (c) male rats from Charles River compared to their VEH counterparts (post hoc ...
-
bioRxiv - Neuroscience 2024Quote: ... and the probability to approach the food cup (treatment x vendor: p=0.035, post hoc: ***p=0.001) in male rats from Charles River.
-
bioRxiv - Neuroscience 2024Quote: ... were placed in the home cage of adult male CD1 mice (3-10 months of age, Charles River), which had been prescreened for aggression prior to encountering the subject mice ...
-
bioRxiv - Neuroscience 2024Quote: ... were purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: 81 male Long-Evans rats (250-300 g) were obtained from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2024Quote: ... Adult C57BL/6J wildtype (WT) mice were obtained from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... male and female C57BL/6 mice to be used as “strangers” were obtained from Charles River Laboratories (Saint-Constant ...
-
bioRxiv - Neuroscience 2024Quote: ... CD-1 mice (Strain: 022) were purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... and were transferred into the oviducts of pseudopregnant ICR females (Charles River). Successful insertions of 3×HA were detected by PCR genotyping of mouse tails and confirmed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... and were transferred into the oviducts of pseudopregnant ICR females (Charles River). Successful insertions of two LoxP sites were detected by PCR genotyping of mouse tails and confirmed by Sanger sequencing (Fig ...
-
bioRxiv - Neuroscience 2024Quote: CD1 wild-type mice were purchased from Charles River Laboratories (Wilmington MA ...
-
bioRxiv - Neuroscience 2024Quote: Male B6/J-Crl1 mice of strain C57BL/6J (orig. Charles River) were bred and maintained at our in-house facility ...
-
bioRxiv - Neuroscience 2024Quote: 3-month-old C57BL/6N male mice (Charles River, Sulzfeld, Germany) were used with ad libitum access to water and food ...
-
bioRxiv - Neuroscience 2024Quote: ... Pregnant female Sprague–Dawley rats were purchased from Charles River Laboratories (Wilmigton ...
-
bioRxiv - Neuroscience 2024Quote: Hippocampal tissues from 2 days postnatal (P2) rats (Sprague-Dawley rats from Charles River) were dissected and collected in 2 ml Eppendorf tubes containing cold DMEM (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: Sprague Dawley rats were provided by Charles River Laboratories (n = 10 ...
-
bioRxiv - Neuroscience 2024Quote: ... Eighteen male and eighteen female Long-Evans rats (200-225g, Charles River Laboratories, San Diego, CA) were randomly divided into six experimental groups ...
-
bioRxiv - Neuroscience 2024Quote: ... WT C57BL6 mice (Charles River) were used for CUT&RUN experiments.
-
bioRxiv - Neuroscience 2024Quote: ... Some whole-cell patch clamp recordings were obtained from CD1 mice (Charles River Laboratories USA). All animals were maintained in standard housing and all animal work was reviewed for compliance and approved by the Animal Care and Use Committees of The Jackson Laboratory (anatomical experiments) ...
-
bioRxiv - Neuroscience 2024Quote: ... C57BL/6J mice (Charles River Laboratories, Sulzfeld, Germany) were kept on a 12/12 h light-dark cycle with light on at 7:00 and off at 19:00 ...
-
bioRxiv - Neuroscience 2024Quote: All subjects were wildtype Sprague-Dawley rats (Charles River). We used female (n=4 ...
-
bioRxiv - Neuroscience 2024Quote: ... Mice carrying the PER2::LUC reporter (Yoo et al., 2004) were bred either on a pigmented C57BL/6J (Charles River Laboratories, France) or albino RjOrl:SWISS (Janvier labs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Female BALB/c mice were purchased from Charles River (Sulzfeld, Germany) and received a daily dose of 62.5 mg IMQ cream (5% ...