Labshake search
Citations for Charles River Labs :
1801 - 1850 of 1855 citations for Mouse G Protein Coupled Receptor Family C Group 6 Member A GPRC6A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: The system was tested on white (or albino) hairy mice of the B6 and BALB/c strains (Charles River Laboratories Japan, Japan). Experiments on healthy mice were performed using 9-week-old female mice ...
-
bioRxiv - Immunology 2023Quote: Wild-type (BALB/c or C57BL/6J) mice were obtained from a commercial supplier (Envigo, Hillcrest, UK or Charles River, Margate UK). Il13eGFP(C57BL6/J)52 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tumor inoculation was performed by injecting 5 × 104 4T1 cells in a volume of 50 μL of sterile PBS into the number four inguinal right MFPs of 8-to 10-week old female Nu/Nu or Balb/C mice (Charles River Laboratories). In CD8+ T cell reduction experiments ...
-
bioRxiv - Bioengineering 2023Quote: ... 1×107 PANC-1 cells in 150 μL of 1×PBS were injected in the right flank region of the mice (BALB/c nude, female, 4-5 weeks old, Charles River, USA).
-
bioRxiv - Bioengineering 2023Quote: ... 1×107 4T1 cells in 150 μL of 1×PBS were injected in the right flank region of the mice (BALB/c, female, 4-5 weeks old, Charles River, USA).
-
bioRxiv - Microbiology 2024Quote: Multidose PK of T and TBAJ-587 in plasma was characterized in infected female BALB/c mice (Charles River Laboratories, Wilmington, MA) receiving oral doses once daily ...
-
bioRxiv - Cell Biology 2020Quote: Mouse eyes were collected from male and female 12-week-old CD1 mice obtained from Charles River Laboratories ...
-
bioRxiv - Developmental Biology 2019Quote: Mouse oocytes were collected at the germinal vesicle stage from the ovaries of CD1 females (Charles River) aged ∼3months ...
-
bioRxiv - Bioengineering 2019Quote: An 8-week-old nude female mouse (nu/nu, strain code: 088, Charles River Laboratories, MA, USA) was used to test needle guidance with GNR injection using a well-defined protocol ...
-
bioRxiv - Genetics 2021Quote: All null allele mouse lines were produced in the C57BL/6N strain background available from Charles River, the Jackson Laboratory ...
-
bioRxiv - Genetics 2020Quote: All mouse experiments were performed with C57BL/6J mice obtained from Charles River (Charles River Laboratories, France). All mice were housed in a temperature-controlled system and maintained on a 12-h light/dark cycle (lights on at 7 a.m.) ...
-
bioRxiv - Neuroscience 2022Quote: ... Outbred strain CD1 mouse pups used for some in utero electroporation experiments were ordered from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2024Quote: ... All CPN were isolated and purified from wildtype CD1 mouse pups of both sexes (Charles River Laboratories), enabling subtype-specific expression of fluorescent proteins using unilateral in utero electroporation at embryonic day 14.5 (E14.5) ...
-
bioRxiv - Microbiology 2021Quote: ... Viruses were grown and amplified in 10-day-old specific-pathogen-free research grade chicken embryos at 35°C (Charles River Laboratories; SPAEAS).
-
bioRxiv - Bioengineering 2022Quote: ... Five million cells were injected into the right flank of six- to eight-week-old Balb/c mice (Charles River Laboratories, Wilmington, USA). Mice were housed in the Laboratory Animal Facility of the Stanford University Medical Center (Stanford ...
-
bioRxiv - Cancer Biology 2024Quote: ... were mixed with Corning Matrigel® matrix growth factor reduced and subcutaneously injected into flanks of 8-week old male BALB/c Nude mice (Charles River Laboratories) as previously described21,30 ...
-
bioRxiv - Genomics 2020Quote: ... Wild-type mouse strains were bred from stocks in-house or otherwise supplied by Charles River (L’Arbresle, France) or MRC Harwell ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cell line was screened for the presence of mycoplasma and mouse pathogens (at Charles River Laboratories, USA) before culturing and never cultured for more than five passages.
-
bioRxiv - Developmental Biology 2021Quote: ChIP-seq was performed using dissected whole lungs from E14.5 CD-1 mouse embryos obtained from Charles River. Chromatin was prepared as previously described (Steimle et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse submandibular salivary glands (SMGs) were dissected from timed-pregnant female mice (strain CD-1, Charles River Laboratories) at embryonic day 14 (E14) ...
-
bioRxiv - Genetics 2022Quote: ... the mouse oocytes were collected from 4-5-week-old C57BL/6N females’ mice (purchased from Charles River), In addition ...
-
bioRxiv - Immunology 2020Quote: ... Mice were infected with the mouse adapted influenza virus A/Puerto Rico/8/34 (H1N1) (PR8) (Charles River Laboratories Avian Vaccine Services ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was injected into the amniotic cavity of embryonic day (E) 9 CD1/NCrl mouse embryos (Charles River Labs). Injections were carried out under ultra-sound guidance using the Vevo 2100 ultrasound imaging system (Visualsonics ...
-
bioRxiv - Cell Biology 2024Quote: Mouse embryonic fibroblasts (MEFs) were prepared from 12.5-day-old embryos of OF1 or DR4 mice (Charles River). Conventional rabbit iPSCs B19 ...
-
bioRxiv - Cancer Biology 2024Quote: FFPE tumor sections from nine different patient-derived ICC xenograft (PDX) mouse models were provided by Charles River Germany (am Flughafen 12-14 ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse oocytes were collected at the GV stage from the ovaries of CD1 females (Charles River Crl:CD1(ICR) 022 ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Cancer Biology 2020Quote: ... 1 × 106 EMT6 cells (ATCC®, CRL2755™) were injected into the fourth mammary fad pad of female Balb/c mice (Charles River Labs). Tumors were allowed to grow up to 50-100 mm3 in size ...
-
bioRxiv - Cell Biology 2024Quote: ... hippocampal pruning analysis was performed on TTLL1 constitutive knock-out 14 (named here TTLL1KO; gift from Dr. C. Janke, Institut Curie, Orsay, France) backcrossed to CD-1 (Charles River, Strain Code 022) for three generations ...
-
bioRxiv - Neuroscience 2020Quote: The following mouse strains/lines were used in this study: CD-1® IGS (Charles River Laboratories, Stock # 022); C57BL/6J (The Jackson Laboratory ...
-
bioRxiv - Biochemistry 2023Quote: Primary neuronal cultures were obtained from cerebral cortex of mouse embryos at gestation day 14–16 (Charles River Laboratories). The neurons were dissociated using Papain Dissociation System (Worthington Biochemical Corporation ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Cancer Biology 2019Quote: ... The specific pathogen free status of these cells was confirmed by PCR screening for mouse/rat comprehensive panel (Charles River). MC38 ...
-
bioRxiv - Molecular Biology 2021Quote: Collection of GAM data from dopaminergic neurons was performed using one C57Bl/6NCrl (RRID: IMSR_CR:027; WT) mouse which were purchased from Charles River, and from one TH-GFP (B6.Cg-Tg(TH-GFP)21-31/C57B6 ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Immunology 2019Quote: ... Pb ANKA and Pb K173 stabilates were subjected to a Mouse/Rat Comprehensive Clear Panel for PCR infectious agent testing (PRIA, Charles River). Further detection and quantitation of LDV particles were done with a simple PCR LDV test (Charles River ...
-
bioRxiv - Microbiology 2021Quote: ... Six to wight week old female C57BL/6 mice were housed (n=10) and the mouse-adapted influenza strainsA/PR/8/34 (H1N1;PR8) were provided by Charles River Laboratories ...
-
bioRxiv - Genetics 2020Quote: ... approximately 15/mouse) into the fallopian tubes of CD1 female recipients rendered pseudopregnant by mating with B6C3F1 vasectomized males (purchased from Charles River).
-
bioRxiv - Microbiology 2020Quote: ... and were bred and maintained at VRI in a vivarium free from >40 murine pathogens as determined through biannual nucleic acid testing (Mouse Surveillance Plus PRIA; Charles River) of sentinel mice exposed to mixed bedding ...
-
bioRxiv - Physiology 2022Quote: Mouse-adapted IAV A/Puerto Rico/8/934 (H1N1) was propagated in 8-day old embryonated chicken eggs (Charles River Laboratories), diluted in DPBS containing Ca2+ and Mg2+ ...
-
bioRxiv - Developmental Biology 2023Quote: The following two species were used in this study: wildtype mice (Charles River; CD-1® IGS mouse, strain code 022), and wildtype rats (Charles River ...
-
bioRxiv - Neuroscience 2023Quote: Preparation and maintenance of dissociated spinal cord-DRG cultures from E13 CD1 mouse embryos (Charles River Laboratories, St. Constant, QC, Canada) were as previously described [22] ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... high-titer of lentiviral particles (mECE20 mixed with mCherry which allows the visualization of infected mice at harvest) were delivered into the amniotic cavity of embryonic day (E) 9 CD1/NCrl mouse embryos (Charles River Labs). Injections were performed under ultra-sound guidance using the Vevo 2100 ultrasound imaging system (Visualsonics ...
-
bioRxiv - Neuroscience 2020Quote: Adult animals (12 weeks old male or female mice) were taken from the mouse strain CD1 (Strain code: 022, Charles River, Sulzfeld, Germany) to isolate the hippocampi ...
-
bioRxiv - Developmental Biology 2022Quote: ... post-ganglionic NBPIs were surgically created in P5 wildtype female and male mice (Charles River; CD-1® IGS mouse, strain code 022) by extraforaminal nerve root excision under isoflurane anesthesia ...
-
bioRxiv - Neuroscience 2020Quote: ... Adult animals (12 weeks old male or female mice) were taken from the mouse strain CD1 (Strain code: 022, Charles River, Sulzfeld, Germany) to isolate the hippocampi ...
-
bioRxiv - Bioengineering 2022Quote: ... Mouse fat samples were obtained from the perigonadal regions of 7- and 67-day old mice (CD-1 strain; Charles River, Wilmington, MA, USA) and directly used for lipidomics and fluorescence imaging.