Labshake search
Citations for Charles River Labs :
1601 - 1650 of 1754 citations for Mouse G Protein Coupled Receptor Family C Group 6 Member A GPRC6A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: Adult male C57BL/6 mice (8-16 weeks) or CD1 mice (8-16 weeks) were obtained from Charles River (Cambridge, UK; RRID:IMSR_JAX:000664) and male GPR35-/- mice (C57BL/6-Gpr35tm1b(EUCOMM)Hmgu/WtsiH ...
-
bioRxiv - Cancer Biology 2023Quote: ... tumor organoids were implanted (6 per brain) into the right frontal cortex of female nude mice (athymic nude mice, Charles River Laboratories, France). Animals were housed in a specific pathogen-free (SPF ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cell suspension was injected subcutaneously (s.c.) into the flank of 6–8-week-old female NMRI-Foxn1nu/Foxn1nu mice (Charles River Laboratories, L‘Arbresle, France). Mice were sacrificed 3 weeks after inoculation ...
-
bioRxiv - Cancer Biology 2021Quote: Tumour growth on chicken embryo chorioallantoic membranes (CAMs)3 or Balb/c nude mice (Charles River, #490) was performed as described previously29 ...
-
bioRxiv - Neuroscience 2021Quote: ... Adult BALB/c male mice were purchased from Charles River (8-10 weeks old; Wilmington, MA, USA) and housed under a 12:12 light:dark cycle with ad libitum access to standard mouse chow and water.
-
bioRxiv - Immunology 2021Quote: ... Six-to-eight-week-old specific pathogen-free female Balb/c mice were purchased from Charles River and kept at the institutional animal facility under specified pathogen-free conditions ...
-
bioRxiv - Neuroscience 2022Quote: Adult male and female Balb/C mice (F0; approximately 3 months of age) purchased from Charles River were used to generate offspring for these studies ...
-
bioRxiv - Immunology 2022Quote: ... and combinations of both components in naïve mice were conducted as follows: BALB/c mice (Charles River Laboratories ...
-
bioRxiv - Immunology 2024Quote: BALB/cAnNCrl wild-type and BALB/c CAnN.Cg-Foxn1nu/Crl athymic mice were purchased from Charles River Laboratories or bred for in vivo experiments ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: Male and female Wistar rats (n=10, weighing 200-250 g at the time of arrival, and obtained from Charles River (Sulzfeld, Germany)) were used for breeding ...
-
bioRxiv - Physiology 2023Quote: Fifteen sexually mature female CD-1 mice (sacrificial age ∼ 34 weeks; mass = 44.1 ± 7.9 g) were obtained (Charles River Laboratories, Senneville, QC, Canada) with approval from the University of Guelph’s Animal Care Committee and all protocols followed CCAC guidelines ...
-
bioRxiv - Neuroscience 2024Quote: Female Sprague-Dawley rats (∼200 g and 9 weeks on arrival, witnesses/controls) and male Sprague-Dawley rats (∼250 g on arrival, intruders) were obtained from Charles River (Durham, NC) while male Long-Evans retired breeders (600-800 g ...
-
bioRxiv - Pathology 2024Quote: ... aged 12–14 weeks) (Harlan, Venray, The Netherlands) or spontaneously hypertensive male Wistar-Kyoto (280–320 g, aged 12–14 weeks) (Charles River, Sulzfeld, Germany) were randomly allocated to their respective control group after an acclimatization period ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Hippocampi were isolated from postnatal day 0 (P0) CD-1 mouse (Charles River) brain tissues and digested with 10U/mL papain (Worthington Biochemical Corp ...
-
bioRxiv - Neuroscience 2021Quote: ... DRG was dissected from embryonic days 13.5-14.5 CD1 mouse (Charles River Laboratories) and incubated with 0.05% Trypsin solution at 37 °C for 20 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Pou2f3−/− mice were generated as described previously (67) and compared to C57BL/6 mice bred in-house (originally from Charles River Laboratories, Wilmington, MA). Ltc4sfl/fl mice were provided by Dr ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: Cohorts of specific pathogen free (SPF, according to FELASAs exclusion list) male and female C57BL/6 mice were purchased from Charles River (strain C57BL/6J), Germany ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5-6 x 106 ID8-Trp53−/− cells in 200 µl of PBS were transplanted via intra-peritoneal (IP) injections in eight to ten-week old female C57BL/6 mice (Charles River Laboratories International Inc). Approximately 4 weeks post tumour cell implantation ...
-
bioRxiv - Cancer Biology 2022Quote: ... PDAC cells (1×106) in 100 μl PBS were injected in the spleen of nude mice (CD-1nu, females, 6-week old; Charles River Laboratories, Wilmington, MA). Surgical clips were typically removed 7 days after surgery and mice were sacrificed 21 days after inoculation ...
-
bioRxiv - Cancer Biology 2021Quote: 10 million TOV21G cells infected with GFP lentivirus were injected intraperitoneally into athymic nude female mice at 6 weeks of age (Charles River Laboratories, Crl:NU(NCr)-Foxn1nu) ...
-
bioRxiv - Cancer Biology 2022Quote: ... MCF7-BM02-1 or MCF7-BM02-TAM67 were made to transplant the cells into 6-week-old female NOD.CB-17-Prkdc
/J mice (NOD/scid, Charles River Japan, Inc., Kanagawa, Japan)56,58 ... -
bioRxiv - Immunology 2022Quote: ... Brca1-/-luciferase-tagged cells in PBS were injected via intraperitoneal route in 8–10-week-old female C57BL/6 mice (Charles River Laboratories International Inc.). Imaging was started at day-7 post-cell injection ...
-
bioRxiv - Microbiology 2023Quote: ... Rag2+/− and TCRβ+/− mice were derived in our animal facility by breeding the knockout strains to C57BL/6 wild-type mice (Charles River strain number 556). Unless otherwise specified ...
-
bioRxiv - Cell Biology 2023Quote: Complete spinal cord transection at T8 was performed in male Sprague Dawley rats (6-7 weeks of age, ∼250 grams, Charles River Laboratories, Wilmington, MA) under isoflurane anesthesia essentially as described [17] ...
-
Multi-omics characterization of partial chemical reprogramming reveals evidence of cell rejuvenationbioRxiv - Molecular Biology 2023Quote: ... and old (20-month-old) male C57BL/6 mice were acquired from the National Institute on Aging (NIA) aged rodent colonies (Charles River Laboratories, Wilmington, MA) and were fed standard 5053 chow ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Immunology 2019Quote: All experiments were conducted with female 8 to 12-weeks-old BALB/c mice (Charles River, Sulzfeld, Germany). Mice were maintained in individually ventilated (IVC ...
-
bioRxiv - Microbiology 2021Quote: ... Female BALB/c mice (8-12 weeks) were used in these experiments and were purchased from Charles River Laboratories ...
-
bioRxiv - Bioengineering 2019Quote: ... Subcutaneous tumours were established in male BALB/c nude mice (Charles River, 7-10 weeks old, 17-22g) by inoculation of cells from one of three different cancer cell lines in both flanks (1.5×106 LNCaP prostate adenocarcinoma cells ...
-
bioRxiv - Immunology 2022Quote: A total number of 55 BALB/c mice (BALB/cAnNCrl, 7 weeks of age) purchased from Charles River Laboratories (Sulzfeld ...
-
bioRxiv - Immunology 2022Quote: Female BALB/c mice aged 8-10 weeks at the start of study were purchased from Charles River Laboratories (Germany) ...
-
bioRxiv - Microbiology 2023Quote: Female Balb/c mice were purchased at the age of 4 to 5 weeks old from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: Experiments were carried out with male Lister Hooded rats (3 months old, 250-300 g at the beginning of the experiments) provided by an authorized supplier (Charles River Laboratories, Barcelona, Spain). Upon their arrival at Pablo de Olavide Animal House (Seville ...
-
bioRxiv - Physiology 2020Quote: White fat adipocytes were isolated from the epididymal fat pads of male CD-1 mice (fed ad libitum, 12 hr. dark/light cycle, weight 25 – 35 g; Charles River Laboratory, Kent, UK). Adipocytes were isolated by collagenase digestion as previously described (Bentley et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... male Spontaneously Hypertensive Rats (SHR) (n=15) and Wistar Kyoto rats (WKY) (n=13) (50–60 g on arrival, Charles River Laboratories, Wilmington MA) were used in the present study ...
-
bioRxiv - Microbiology 2022Quote: ... Endochrome-K kit (Charles River) was used ...
-
bioRxiv - Biophysics 2020Quote: ... tumour was generated by injecting 1 × 106 MDA-MB-231 cells into the lower right MFP of 4 female NOD scid gamma (NSG) mice (6-7 weeks old; Charles River Laboratories, Wilmington, MA, USA). Cells were suspended in 0.05 mL of HBSS per injection ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 μL of the cell suspension were injected stereotactically into the striatum of 6–8-week-old female severe combined immunodeficient (SCID) mice (Charles River Frederick Research Model Facility) using a stereotactic device ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2020) were generated as previously described and compared to age and sex matched wild-type C57Bl/6 controls (Charles River, UK or Vital-River, China). Endothelial-specific cyclo-oxygenase-1 knockout mice (Ptgs1flox/flox ...
-
bioRxiv - Neuroscience 2023Quote: ... C57BL/6J mice (7–8 weeks old) were acquired from The Jackson Laboratories and CD1 retired breeder mice (4–6 months old) from Charles River (St. Constant, QC, Canada). A total of 82 animals were used in this study ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary mouse myoblasts (mskMPs) from 3-week-old C57Bl6/J (Charles River, C57BL/6NCrl) mice were maintained in collagen I coated dishes (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... All mouse lines were in the C57BL/6J background (>10 generations, Charles River, USA), besides Scn1a+/− mice that were in a mixed background (C57BL/6J-CD1 85:15%).
-
bioRxiv - Neuroscience 2021Quote: ... Biological specimens for imaging were obtained from a C57Bl6 mouse (Charles River Labs, UK) expressing mCherry sparsely in neurons of the Lateral Posterior nucleus (LP ...
-
bioRxiv - Neuroscience 2021Quote: ... The following mouse strains were used: wild type (C57BL/6N, Charles River Laboratories #027), Ai14 (JAX ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... and the resident was a white coat-coloured CD-1 mouse (Charles River, #022). For the rat resident-intruder protocol ...
-
bioRxiv - Genetics 2020Quote: ... We isolated mouse connective tissue from 8–10 week old CD1 mice (Charles River), intervertebral discs (IVDs ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).