Labshake search
Citations for Promega :
351 - 400 of 5334 citations for rno mir 143 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and the Glomax Multi+ Detection System (Promega). All data were standardized for Renilla activity ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse transcribed with AMV RT (Promega) primed with random 9-mers ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcribed by M-MLV RT (Promega) using sRNA0030R1 primer (Table S3) ...
-
bioRxiv - Pathology 2020Quote: ... using GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and reverse-transcribed using AMV RT (Promega). cDNA was quantified by qPCR using iTaq Universal SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... and reverse transcribed with AMV RT (Promega) primed with random 9-mers ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse transcribed with MMLV-RT (Promega). The RT reactions were amplified with primers for target RNA and ACTIN (Supplemental Table S2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and reverse transcribed with MMLV-RT (Promega) using oligo-dT primers ...
-
bioRxiv - Microbiology 2023Quote: ... and 1µl of AMV RT enzyme (Promega) for a 50µl reaction volume ...
-
bioRxiv - Cell Biology 2024Quote: ... and reverse-transcribed with AMV-RT (Promega) and random 9-mer primers ...
-
bioRxiv - Microbiology 2023Quote: ... and reverse transcribed using AMV RT (Promega) and random 9-mers in the presence of RNasin (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... Screening for recombinant colonies was made by PCR as previously described [66] using the PCR conditions described above and the GoTag kit (Promega, M3001).
-
bioRxiv - Cell Biology 2019Quote: Glucose uptake was measured based on the detection of 2-deoxyglucose-6-phosphate uptake by a commercially available luminescence-based kit (Glucose Uptake-GloTM Assay, Promega) on a SpectraMax M3 (Molecular Devices) ...
-
bioRxiv - Neuroscience 2019Quote: ATP levels were assessed with luciferin-luciferase based assay (Lundin & Thore, 1975; McElroy & DeLuca, 1983) using a commercial ATP assay system with bioluminescence detection kit (Enliten, Promega). ATP was measured according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... The luminescence signal was developed for 20 min after adding 40 µl kinase detection reagent (kit) and measured with a GloMaxMulti plate reader (Promega). The average of three experiments performed in duplicate and normalized to PI3KC3-C1 activity were determined ...
-
bioRxiv - Microbiology 2021Quote: ... from 12-72 hpt and luciferase activity was measured using the Dual Luciferase reagent kit and GloMax multi detection system (Promega). Firefly luciferase readings from the TBEV replicons were normalized to the Renilla values (pTK-Ren ...
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... Apoptosis was detected by terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling (TUNEL) assays using in situ cell death detection kit (Promega). All images were acquired using a Zeiss LSM710 confocal microscope and Zen software (Zeiss).
-
bioRxiv - Molecular Biology 2022Quote: For Lytic endpoint measurements cells were seeded as mentioned above and NanoLuc abundance was determined via the Nano-Glo HiBit lytic detection kit (Promega) following manufacturers recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... All VLP volumes were calculated and normalized to 1.4 x 107 RLU using the Nano-Glo® HiBiT Lytic Detection System kit (Promega).
-
bioRxiv - Microbiology 2022Quote: ... 48 h post transfection cells were harvested for western blotting or luminescence detection using a Firefly Luciferase Assay kit (Promega) and a Glomax luminometer (Promega) ...
-
bioRxiv - Immunology 2023Quote: In situ nick-end labeling of nuclear DNA fragmentation was performed with a TUNEL apoptosis detection kit (DeadEnd Fluorometric TUNEL system, Promega) according to the supplier’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... followed by a DNase I treatment and a subsequent reverse transcription with oligo d[T]18 using the GoScript RT kit (Promega). One-step RT-qPCR was performed using the SYBR FAST Mix optimized for LightCycler 480 (KAPA ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT) and sequentially digested with Lys-C (Wako) (protein:enzyme ratio 1:50, o/n at RT) and trypsin (Promega) (protein:enzyme ratio 1:100 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 20 minutes in the dark, RT) and sequentially digested with Lys-C (Wako) (protein:enzyme ratio 1:50, overnight at RT) and trypsin (Promega) (protein:enzyme ratio 1:100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... RT) and sequentially digested with Lys-C (Wako) (protein:enzyme ratio 1:100, o/n at RT) and trypsin (Promega) (protein:enzyme ratio 1:100 ...
-
bioRxiv - Microbiology 2023Quote: ... RT), alkylated (55 mM IAM, 45 min, RT, in the dark) and digested with 0.5 μg of trypsin (Promega). Tryptic peptides were desalted using a POROSTM R2 resin (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Cancer Biology 2019Quote: A wild-type or mut-hsa-miR-329-5p fragment was constructed and inserted downstream of the luciferase reporter gene of the pmirGLO Vector (Promega, USA). We used ExFect 2000 Transfection Reagent to transfect the reporter plasmid into 293T cells ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA samples were then purified using the Wizard SV PCR purification kit (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2022Quote: ... and the first second PCR kits were obtained from Promega (M7122, Madison, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was then purified using a Promega PCR Clean-Up Kit (Promega #A9282), quantified (Synergy HTX ...
-
bioRxiv - Neuroscience 2023Quote: ... extracellular and intracellular assays were performed to determine levels of HiBiT-tagged F3 using either the Nano-Glo HiBiT Extracellular Detection System or the Nano-Glo HiBiT Lytic Detection System (Promega). For the extracellular HiBiT protocol ...
-
bioRxiv - Microbiology 2021Quote: ... A series of concentrations from 50-600nM in symmetric and asymmetric forward and reverse primer concentrations were added to the RT-qPCR reaction using the GoTaq 1-Step RT-qPCR System (Promega) according to the manufacturer’s instructions using the standard annealing temperature of 60°C ...
-
bioRxiv - Microbiology 2020Quote: RT-qPCR analyses of NoV GII were carried out using GoTaq® Probe 1-Step RT-qPCR System (Promega, USA). Primers and the FAM/TAMRA-labelled probe of NoV GII were according to ISO 15216-1:2017 ...
-
bioRxiv - Microbiology 2022Quote: RT-qPCR analyses of NoV GII were carried out using GoTaq® Probe 1-Step RT-qPCR System (Promega, USA). Primers and the FAM/TAMRA-labelled probe of hNoV GII were according to ISO 15216-1:2017 ...
-
bioRxiv - Biochemistry 2020Quote: ... on a GloMax-discover multimode detection system (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genomics 2022Quote: ... the Nano-Glo HiBiT Lytic Detection System (Promega) was used for the quantification of the HiBiT tags ...
-
bioRxiv - Immunology 2020Quote: ... and a GloMax-Multi Detection System (Promega, USA).
-
bioRxiv - Pathology 2020Quote: ... and GloMax-Multi Detection System Photometer (Promega, USA).
-
bioRxiv - Cell Biology 2019Quote: ... 2° antibodies α- mouse (HRP detection, Promega, W4021). The mean intensity quantification of 4 independent experiments is shown in Figure 4 – supplement 1B ...
-
bioRxiv - Microbiology 2022Quote: ... which was detected with luciferase detection reagent (Promega). Luminescence measurements were done using a LUMIstar OMEGA plate reader (BMG ...
-
bioRxiv - Systems Biology 2023Quote: ... 10 µl of MTase-Glo Detection Solution (Promega) was added ...
-
bioRxiv - Cell Biology 2023Quote: ... we added 10 μl of detection reagent (Promega) to the system ...
-
bioRxiv - Molecular Biology 2023Quote: ... then 25 μl MTa-Glo Detection Solution (Promega) was added and incubated for a further 30 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 µL Luciferin Detection Reagent (Promega Cat #TM344) was added to all wells ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by luminescence detection using GloMax Explorer (Promega). The bioluminescence readings were averaged amongst the n=3 technical replicates for each construct and ratio ...
-
bioRxiv - Cancer Biology 2024Quote: The NanoBRET™ Nano-Glo detection System (Promega) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plates containing the different transfected cells were incubated for 24 hours at 37°C before the luciferase activity was measured using the Dual-Glo luciferase detection kit (Promega: E2920).
-
bioRxiv - Physiology 2021Quote: ... Extracts were used for quantification of luciferase as proxy for ATP content using the ENLITEN® ATP Assay System Bioluminescence Detection Kit (Promega) according to the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...