Labshake search
Citations for Promega :
401 - 450 of 2430 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Reactions were set using the RiboMAX™ Large Scale RNA Production System (Promega) and incubated at 37ºC overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... qPCR reactions were set up with GoTaq qPCR Master Mix reagent system (Promega) and run on a StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... RNA samples and the negative extraction controls were screened in duplicate to investigate the presence of YFV RNA by RT-qPCR (GoTaq Probe 1-Step RT-qPCR System-Promega, USA), with primers and probes targeting the 5’-noncoding regions of the YFV genome (39) ...
-
bioRxiv - Evolutionary Biology 2023Quote: Target gene and AAEL002401(reference gene) expression was quantified by RT-qPCR using FAM- and HEX -labelled GoTaq® Probe qPCR and RT-qPCR assay (Promega), TaqMan universal PCR master mix (Promega ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Levels of reporter mRNAs in eggs were measured 6 hrs post-injection by RT-qPCR using the GoTaq 2-Step RT-qPCR system as per manufacturer’s instructions (Promega, Madison, WI) with random primers for reverse transcription and oligos listed in Table 1 for the qPCR step.
-
bioRxiv - Genetics 2021Quote: ... Colonies were genotyped using the T7/SP6 primers (Promega). Plasmids from the validated colonies were isolated using the QIAprep Spin Miniprep Kit (QIAGEN ...
-
bioRxiv - Genomics 2021Quote: ... and Oligo (dT) 15 primer (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and Oligo (dT) 15 primer (Promega, Madison, WI, USA). STEP ONE PLUS Real Time PCR system (Applied Biosystems Japan ...
-
bioRxiv - Plant Biology 2020Quote: ... the cDNA was synthesized using oligo(dT) primer (Promega) with 18S rRNA specific primer and ReverTraAce reverse transcriptase (Toyobo) ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 µl random primers (50 ng·µl−1, Promega, C1181), 2 µL 0.1M DTT ...
-
bioRxiv - Microbiology 2021Quote: ... according to the manufacturers’ protocol with random primers (Promega). Two microliters of diluted cDNA were amplified with SYBR™ Green PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... random primers and RNasin® ribonuclease inhibitor (Promega N2511). All these steps were carried out following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis was performed using random primers (Promega, C1181) and M-MLV Reverse Transcriptase RNase H (Solis BioDyne ...
-
bioRxiv - Developmental Biology 2019Quote: ... RNA was reverse transcribed using 250ng random primers (Promega), 0.5mM dNTPs (Promega) ...
-
bioRxiv - Genetics 2020Quote: ... with both random hexamer and oligo(dT) primers (Promega) after the DNase (Promega ...
-
bioRxiv - Immunology 2021Quote: ... 1µl of random hexamer primers (Promega, Catalogue no.-C118A) were added to the RNA ...
-
bioRxiv - Plant Biology 2023Quote: ... oligo(dT) primer and reverse transcriptase ImProm-II (Promega). Two-step quantitative real-time PCR(qPCR ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 μL random primers (50 ng/μL, Promega, C1181), 2 μL 0.1 M DTT ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then 150 mg/kg D-luciferin (VivoGlo, Promega, Madison, WI) was injected intraperitoneally ...
-
bioRxiv - Cancer Biology 2020Quote: ... injection of 150 mg/kg Luciferin-EF (E6552; Promega, Madison, WI) in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... The partial frame of circ_0005962 containing the binding site or mutant binding site (wild-type or mutant-type) with miR-382-5p was amplified and cloned into the downstream of pGL4 vector (Promega, Madison, WI, USA) to generate circ_0005962-wt and circ_0005962-mut fusion plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1-3μl aliquots were taken for reverse transcription (RT) using the Moloney murine leukemia virus RT RNase H (−) (Promega, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: The quantification of viral RNA was carried out in one-step RT-qPCR using 3 µl of the eluted RNA with the GoTaq® Probe One-step RT-qPCR System (Promega, Poland). This procedure employed in-house primers and a probe specifically tailored for the HCoV-229E N sequence ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was synthesized using M-MLV RT (H–) (Promega) and U3 antisense primer 5’-TGTGTGGTAGATCCACATCG-3’ ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5 µL reverse transcriptase (RT, Promega, Madison, Wisconsin, US) and RNase-free water were added ...
-
bioRxiv - Pathology 2022Quote: ... 200 units reverse transcriptase (M-MLV RT, M1701, Promega), 2mM dNTPs and 20 units RNAsin (N2615 ...
-
bioRxiv - Immunology 2020Quote: ... and M-MLV RT RNAse (H-) Point Mutant (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... we used 5 μL of 5X RT buffer (Promega), 5 μL of dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... the GoTaq® 1-Step RT-qPCR System (Promega) was used with the primers (F ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were equilibrated to RT and CellTiter-Glo (Promega) solution (100μL ...
-
bioRxiv - Biochemistry 2021Quote: ... and GoTaq® 1-Step RT-qPCR System (Promega) were used for RT-qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were re-suspended into 150 µL of Nuclei lysis buffer (Promega) containing 0.05 % SDS ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in 150 μl of Renilla lysis buffer (RLB1X, Promega) and frozen at −80°C ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed with 150 μl of Passive Lysis Buffer (PLB1X, Promega) and frozen at −80°C for at least 10 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were lysed in 150 µl 1X cell culture lysis buffer (Promega). Luciferase activity present in 10 µl of lysate clarified by centrifugation was then quantitated in white 96-well luminometer plate (Microlumat Plus 1b 96V instrument ...
-
bioRxiv - Cancer Biology 2023Quote: ... mice were injected with 150 mg/kg body mass D-luciferin (Promega) via intraperitoneal injection ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg total RNA and 0.5 μg random primers (Promega) were used with the GoScript Reverse transcriptase (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega ...
-
bioRxiv - Immunology 2021Quote: ... RNA was reverse transcribed using oligo(dT) primers (Promega, C1101), M-MLV (Promega ...
-
bioRxiv - Molecular Biology 2019Quote: ... and RNA was reverse transcribed with Random Primers (Promega C1181) and MMLV Reverse Transcriptase (Sigma M1302 ...
-
bioRxiv - Physiology 2019Quote: ... and a mix of oligo dT and random primers (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... in the presence of oligo(dT)15 Primer (Promega, #C1101), dNTPs (Euroclone) ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by primer extension with 2U AMV reverse transcriptase (Promega) in supplied buffer containing 1 mM ddNTP ...
-
bioRxiv - Microbiology 2020Quote: ... 1 µg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega ...
-
bioRxiv - Developmental Biology 2022Quote: ... Each reaction mixture (20 µL) also included hexadeoxynucleotide primers (Promega), dNTPs and RNasin (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: ... primer extension reactions were done using AMV reverse transcriptase (Promega) and 32P-labeled primer (Pisarev et al. ...
-
bioRxiv - Physiology 2023Quote: ... and oligo(dT)15 primers (Promega, C110A, Madison, WI, USA). Quantitative real-time RT-PCR was performed in a Rotor-Gene Q (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega ...